ID: 1173721980

View in Genome Browser
Species Human (GRCh38)
Location 20:45267516-45267538
Sequence GGATGAATTCCCGAGCAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173721977_1173721980 10 Left 1173721977 20:45267483-45267505 CCCATACATACATGGTAAAATTG No data
Right 1173721980 20:45267516-45267538 GGATGAATTCCCGAGCAATTTGG No data
1173721976_1173721980 11 Left 1173721976 20:45267482-45267504 CCCCATACATACATGGTAAAATT No data
Right 1173721980 20:45267516-45267538 GGATGAATTCCCGAGCAATTTGG No data
1173721978_1173721980 9 Left 1173721978 20:45267484-45267506 CCATACATACATGGTAAAATTGA No data
Right 1173721980 20:45267516-45267538 GGATGAATTCCCGAGCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173721980 Original CRISPR GGATGAATTCCCGAGCAATT TGG Intergenic
No off target data available for this crispr