ID: 1173722100

View in Genome Browser
Species Human (GRCh38)
Location 20:45268548-45268570
Sequence GACCCTACCTTCAGGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173722100_1173722108 21 Left 1173722100 20:45268548-45268570 CCAGACCCCCTGAAGGTAGGGTC No data
Right 1173722108 20:45268592-45268614 AGTCAGATGCACTCTCACAAGGG No data
1173722100_1173722107 20 Left 1173722100 20:45268548-45268570 CCAGACCCCCTGAAGGTAGGGTC No data
Right 1173722107 20:45268591-45268613 CAGTCAGATGCACTCTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173722100 Original CRISPR GACCCTACCTTCAGGGGGTC TGG (reversed) Intergenic
No off target data available for this crispr