ID: 1173722108

View in Genome Browser
Species Human (GRCh38)
Location 20:45268592-45268614
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173722102_1173722108 16 Left 1173722102 20:45268553-45268575 CCCCCTGAAGGTAGGGTCGGCTG No data
Right 1173722108 20:45268592-45268614 AGTCAGATGCACTCTCACAAGGG No data
1173722105_1173722108 13 Left 1173722105 20:45268556-45268578 CCTGAAGGTAGGGTCGGCTGTCA No data
Right 1173722108 20:45268592-45268614 AGTCAGATGCACTCTCACAAGGG No data
1173722103_1173722108 15 Left 1173722103 20:45268554-45268576 CCCCTGAAGGTAGGGTCGGCTGT No data
Right 1173722108 20:45268592-45268614 AGTCAGATGCACTCTCACAAGGG No data
1173722100_1173722108 21 Left 1173722100 20:45268548-45268570 CCAGACCCCCTGAAGGTAGGGTC No data
Right 1173722108 20:45268592-45268614 AGTCAGATGCACTCTCACAAGGG No data
1173722104_1173722108 14 Left 1173722104 20:45268555-45268577 CCCTGAAGGTAGGGTCGGCTGTC No data
Right 1173722108 20:45268592-45268614 AGTCAGATGCACTCTCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173722108 Original CRISPR AGTCAGATGCACTCTCACAA GGG Intergenic
No off target data available for this crispr