ID: 1173722780

View in Genome Browser
Species Human (GRCh38)
Location 20:45273942-45273964
Sequence ATTTTATTCTGGGAAATCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173722780_1173722786 -1 Left 1173722780 20:45273942-45273964 CCAATGATTTCCCAGAATAAAAT No data
Right 1173722786 20:45273964-45273986 TTCTATGTAGGCTGGTAAGAGGG No data
1173722780_1173722785 -2 Left 1173722780 20:45273942-45273964 CCAATGATTTCCCAGAATAAAAT No data
Right 1173722785 20:45273963-45273985 ATTCTATGTAGGCTGGTAAGAGG No data
1173722780_1173722784 -9 Left 1173722780 20:45273942-45273964 CCAATGATTTCCCAGAATAAAAT No data
Right 1173722784 20:45273956-45273978 GAATAAAATTCTATGTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173722780 Original CRISPR ATTTTATTCTGGGAAATCAT TGG (reversed) Intergenic
No off target data available for this crispr