ID: 1173722863

View in Genome Browser
Species Human (GRCh38)
Location 20:45274798-45274820
Sequence GATTGTGGATATTCATATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173722863_1173722867 10 Left 1173722863 20:45274798-45274820 CCATTATATGAATATCCACAATC No data
Right 1173722867 20:45274831-45274853 TTCTTCTATTGACAGGCATTTGG No data
1173722863_1173722870 28 Left 1173722863 20:45274798-45274820 CCATTATATGAATATCCACAATC No data
Right 1173722870 20:45274849-45274871 TTTGGATTTTTTCTAGTTTGGGG No data
1173722863_1173722865 3 Left 1173722863 20:45274798-45274820 CCATTATATGAATATCCACAATC No data
Right 1173722865 20:45274824-45274846 TTATCCATTCTTCTATTGACAGG No data
1173722863_1173722868 26 Left 1173722863 20:45274798-45274820 CCATTATATGAATATCCACAATC No data
Right 1173722868 20:45274847-45274869 CATTTGGATTTTTTCTAGTTTGG No data
1173722863_1173722869 27 Left 1173722863 20:45274798-45274820 CCATTATATGAATATCCACAATC No data
Right 1173722869 20:45274848-45274870 ATTTGGATTTTTTCTAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173722863 Original CRISPR GATTGTGGATATTCATATAA TGG (reversed) Intergenic
No off target data available for this crispr