ID: 1173723463

View in Genome Browser
Species Human (GRCh38)
Location 20:45280133-45280155
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173723461_1173723463 18 Left 1173723461 20:45280092-45280114 CCTCATATACATCTCAAATTTAG No data
Right 1173723463 20:45280133-45280155 CCTGAGCCTCAATTTTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173723463 Original CRISPR CCTGAGCCTCAATTTTTTTG AGG Intergenic
No off target data available for this crispr