ID: 1173726893

View in Genome Browser
Species Human (GRCh38)
Location 20:45304590-45304612
Sequence CGGCGAGAGAACGCGCGGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173726888_1173726893 9 Left 1173726888 20:45304558-45304580 CCAGGTCGCGGATGGCGCGCTCC 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1173726893 20:45304590-45304612 CGGCGAGAGAACGCGCGGAGAGG 0: 1
1: 0
2: 1
3: 9
4: 52
1173726884_1173726893 25 Left 1173726884 20:45304542-45304564 CCTTGCGCCAGAGGCACCAGGTC 0: 1
1: 0
2: 0
3: 16
4: 173
Right 1173726893 20:45304590-45304612 CGGCGAGAGAACGCGCGGAGAGG 0: 1
1: 0
2: 1
3: 9
4: 52
1173726886_1173726893 18 Left 1173726886 20:45304549-45304571 CCAGAGGCACCAGGTCGCGGATG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1173726893 20:45304590-45304612 CGGCGAGAGAACGCGCGGAGAGG 0: 1
1: 0
2: 1
3: 9
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173726893 Original CRISPR CGGCGAGAGAACGCGCGGAG AGG Exonic
901017903 1:6242264-6242286 CAGCTCGAGAACGCGGGGAGGGG + Intergenic
902402921 1:16167752-16167774 AGGCGAGAGGAAGCGCGGCGGGG + Intergenic
902586172 1:17439731-17439753 CGGCAAGCGAGCGCGCGGCGGGG + Intergenic
902931724 1:19736217-19736239 AGGCAAGAGAACGCGTGCAGGGG + Intronic
1067091347 10:43267088-43267110 GGGCGCGAGAGCGCGGGGAGCGG + Intergenic
1070145878 10:73772920-73772942 CGCCCATGGAACGCGCGGAGTGG + Exonic
1077048428 11:556060-556082 CGGCTCGAGGACGCGCGCAGCGG + Exonic
1090086301 11:123654042-123654064 CGGCGAGAGCGGGCGCGGAGCGG - Exonic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1101605986 12:106247977-106247999 CGGCGAGAGGACGCGCGGCCGGG + Exonic
1104724686 12:131068423-131068445 CGGGGAGGGAAGGCGTGGAGTGG + Intronic
1105956482 13:25287601-25287623 CGCCGAGCGGACGCGCGGGGCGG + Exonic
1118925825 14:70188930-70188952 CGCAGAGGGGACGCGCGGAGAGG + Exonic
1120787739 14:88552061-88552083 CGGCCCGGGACCGCGCGGAGAGG + Intronic
1122130869 14:99604086-99604108 CGGCGAGAGGACGCGCCAGGCGG - Intergenic
1122634440 14:103123519-103123541 GGGCGAGAAGCCGCGCGGAGCGG - Exonic
1122779161 14:104136392-104136414 CGGCCAGTGAACGCGCGGGCGGG + Intergenic
1129240084 15:74245759-74245781 GGGACAGAGAACGCGGGGAGGGG + Intronic
1129644835 15:77420215-77420237 GGGCGAGGGCGCGCGCGGAGGGG - Intergenic
1132314351 15:100879592-100879614 GGGCGAGAGAGCGCGCGGCGCGG + Exonic
1142350312 16:89576481-89576503 CGGCGAGGGAGCGCGCGCTGGGG + Intronic
1147927192 17:43953275-43953297 CGGTGAGCGCAGGCGCGGAGCGG - Exonic
1152581185 17:81166230-81166252 GGGCGGGAGCGCGCGCGGAGCGG + Intergenic
1160904790 19:1446990-1447012 CCGCAAGAGAACGCGGGGCGGGG + Intronic
1162486140 19:10961433-10961455 CGGCGAGAGCGCGCGCGGAGAGG - Intronic
1167474268 19:49691065-49691087 CGGGGATAGAACGCGGGGATTGG + Intronic
1168155330 19:54471197-54471219 CGGGGGGAGAACGCGCGGCCCGG - Intronic
934037798 2:88103223-88103245 TGGCGTGAGAACGGGCGGCGGGG + Intronic
935820494 2:106887739-106887761 CCGCGAGAGAACCAGCGGGGTGG - Intergenic
936561280 2:113541789-113541811 CAGCGAGCGGCCGCGCGGAGAGG + Intergenic
941265474 2:163356444-163356466 AGGCGAGAGAAAACCCGGAGAGG + Intergenic
941367025 2:164621561-164621583 CGGCGAGGCAAGGCGCGGAGGGG + Exonic
945119479 2:206443460-206443482 CGGCGCGGGGACGCGCGGAGCGG - Intergenic
1169111313 20:3035966-3035988 GGGAGAGAGAAAGCGAGGAGGGG + Intronic
1173726893 20:45304590-45304612 CGGCGAGAGAACGCGCGGAGAGG + Exonic
1174374075 20:50113681-50113703 CGGCCAGAGAAGGCTTGGAGTGG + Intronic
1175547125 20:59785557-59785579 CTGCAAGAGAAAGCGCAGAGGGG + Intronic
1179150571 21:38805637-38805659 CGGCGAGGGAGCGCGGGGCGGGG - Intronic
1180782402 22:18528615-18528637 CGGCGCGGGAGCGCGCGGAGCGG + Exonic
1181125953 22:20702642-20702664 CGGCGCGGGAGCGCGCGCAGCGG + Intergenic
1181239291 22:21467950-21467972 CGGCGCGGGAGCGCGCGGAGCGG + Intergenic
1183411704 22:37658791-37658813 CTGCGAGAGGCTGCGCGGAGCGG + Exonic
1184759747 22:46537630-46537652 CGGGGAGAGCGCGGGCGGAGTGG - Intergenic
1184906764 22:47493150-47493172 AGGCAAGAGAGCGCGCGCAGGGG - Intergenic
949517700 3:4822055-4822077 CGGCGAGGGAAGGCACAGAGCGG - Intronic
953955388 3:47227897-47227919 CGGAGAGAGAAAGCGGGGAGGGG + Intergenic
960864482 3:122185268-122185290 CGGCGACAGAACACGTAGAGTGG - Intronic
968620775 4:1602658-1602680 CGGGGAGGGGGCGCGCGGAGGGG - Intergenic
973916126 4:55636359-55636381 CGGCGAGGTGACGCGCGGCGGGG - Intronic
988263865 5:28926717-28926739 TGGTGAGAAAAGGCGCGGAGAGG + Intergenic
997013190 5:129903865-129903887 TAGAGAGAGAAGGCGCGGAGTGG + Intergenic
1006860645 6:37169964-37169986 CGGCCACAGAGCGCGCGGGGCGG + Intergenic
1011765016 6:90611060-90611082 GGGGGAGAGGACGCGCGGGGCGG + Intergenic
1014774156 6:125489337-125489359 AGGAGAGAGAAAGCGCGAAGGGG - Intergenic
1018876678 6:167827349-167827371 AGGGGAGAGAAGGGGCGGAGGGG - Intronic
1020252938 7:6483939-6483961 CGGCGGGGGAAGGCCCGGAGAGG - Intronic
1026482518 7:70790634-70790656 CGGCGGGAGCACGAGCGGGGAGG + Exonic
1032068910 7:128791890-128791912 CAGCGAGAGAATGGGAGGAGAGG + Intronic
1035726798 8:1829805-1829827 CGGAGGAAGAACGCGCGGCGAGG + Intronic
1039684262 8:39780147-39780169 AGGCCAGAGAACGCGTGCAGGGG + Intronic
1053732836 9:41074624-41074646 CAGCGAGCGGCCGCGCGGAGAGG - Intergenic
1059321229 9:113471647-113471669 CGGAGAGAGAGAGCGGGGAGGGG - Intronic
1197746052 X:129932624-129932646 CGGCGAGCGAGCGAGCGGAGCGG - Intergenic