ID: 1173729335

View in Genome Browser
Species Human (GRCh38)
Location 20:45317656-45317678
Sequence GTGGACCAGGGAGCAAACAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173729335_1173729345 16 Left 1173729335 20:45317656-45317678 CCTGTGTTTGCTCCCTGGTCCAC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1173729345 20:45317695-45317717 CAGGTGCCTGGACAGTGATGAGG 0: 1
1: 0
2: 6
3: 31
4: 259
1173729335_1173729340 -8 Left 1173729335 20:45317656-45317678 CCTGTGTTTGCTCCCTGGTCCAC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1173729340 20:45317671-45317693 TGGTCCACAGATTTGGTGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 181
1173729335_1173729344 4 Left 1173729335 20:45317656-45317678 CCTGTGTTTGCTCCCTGGTCCAC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1173729344 20:45317683-45317705 TTGGTGGCTGGGCAGGTGCCTGG 0: 1
1: 0
2: 3
3: 53
4: 497
1173729335_1173729341 -7 Left 1173729335 20:45317656-45317678 CCTGTGTTTGCTCCCTGGTCCAC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1173729341 20:45317672-45317694 GGTCCACAGATTTGGTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 160
1173729335_1173729343 -3 Left 1173729335 20:45317656-45317678 CCTGTGTTTGCTCCCTGGTCCAC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1173729343 20:45317676-45317698 CACAGATTTGGTGGCTGGGCAGG 0: 1
1: 0
2: 3
3: 61
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173729335 Original CRISPR GTGGACCAGGGAGCAAACAC AGG (reversed) Exonic
900367939 1:2318893-2318915 GTGGCCCTGGCAGCAAGCACAGG + Intergenic
900533702 1:3167046-3167068 GAGGTGCAGGGAGCGAACACAGG + Intronic
900632743 1:3645597-3645619 GTGGACTTGGGCCCAAACACTGG + Intronic
900835368 1:4999223-4999245 TTGGAACAGGGAGGAAAGACGGG - Intergenic
903632932 1:24790608-24790630 GTGTACCAGGGAGGTCACACAGG - Intronic
904746335 1:32713463-32713485 GTGGACCTGGGAGAGGACACGGG - Intergenic
905960233 1:42036441-42036463 GCTGACCAGGGAGCGAACCCAGG - Intergenic
912564919 1:110580621-110580643 GTGGACAAAGGACCAAACAAGGG - Intergenic
913346958 1:117818907-117818929 GTGGGCCATTCAGCAAACACAGG - Intergenic
915923071 1:159992594-159992616 GGGGAGCAGGGAGGAGACACAGG - Intergenic
920248125 1:204603598-204603620 GTGGACCACGCAGCCAACTCAGG + Intergenic
922988191 1:229882953-229882975 GTGGAGCATGGGGAAAACACAGG - Intergenic
923985019 1:239371945-239371967 GTGAGCCAGGGAGTAAACAAAGG + Intergenic
1063347395 10:5324832-5324854 GTGCTCCAGGGACCTAACACAGG + Intergenic
1064388323 10:14919622-14919644 GTGGACCTGGGACCCACCACAGG - Intronic
1066289688 10:34002472-34002494 GTGGAAAAGGGAGCAAGTACAGG - Intergenic
1067756261 10:49008145-49008167 GTGGACCAGGGAGCCAGCTCAGG - Intergenic
1069594683 10:69663041-69663063 CTGGACCAGGGAGCAGGCACGGG + Intergenic
1069749689 10:70737265-70737287 ATGCATGAGGGAGCAAACACAGG - Intronic
1071367028 10:84909789-84909811 GTGAATCAGGGAGCAAACCAAGG - Intergenic
1074354631 10:112771134-112771156 GTGGACCTGGGTTCAAACCCAGG + Intronic
1074477289 10:113784677-113784699 GTGGAACAGGGAACATACACTGG + Intergenic
1075085979 10:119414609-119414631 GTTGGCCTGGGAGCAAAGACAGG - Intronic
1075091896 10:119448450-119448472 GTGGGCCAGGGAGCCCACATTGG + Intronic
1075516282 10:123111091-123111113 GTGGAAGGGGAAGCAAACACGGG - Intergenic
1077044134 11:537026-537048 GAGGACCAGGAAACACACACCGG - Intronic
1077432096 11:2520734-2520756 GTGCCCCAGGAAGGAAACACTGG - Intronic
1077791424 11:5444590-5444612 GTGAAGCAGGGAGCACTCACTGG + Intronic
1078022701 11:7668858-7668880 GTGAACCAGTGAGTAAACAATGG + Intronic
1083923358 11:65792077-65792099 GTGGACCAGAGAGCCAAAGCAGG + Intronic
1083990295 11:66242496-66242518 GTGGAACAGGGAGCACTCCCCGG + Intronic
1084051432 11:66602733-66602755 GGGGCCCAGGAAGAAAACACAGG - Intronic
1087577261 11:100004776-100004798 GTGGGCCAGGGATCAACCAATGG + Intronic
1088829812 11:113526597-113526619 ATGGAGCAGGGAGAAACCACAGG + Intergenic
1089778635 11:120857203-120857225 CTGGGCCAGGGAGCAAGGACAGG - Intronic
1089808427 11:121112687-121112709 GGGGACCAGGATGCAACCACCGG - Intronic
1090261755 11:125326335-125326357 GTGGGCCAGGGAACTCACACAGG + Intronic
1091616677 12:2054912-2054934 GTGGAGCTGGGAGCAAACAGAGG - Intronic
1094027464 12:25974089-25974111 GTGGTCCAGGGAGAAAGCAGCGG + Intronic
1095485743 12:42682785-42682807 GTGTAACAGGGAGGAAAAACAGG + Intergenic
1097604424 12:61734696-61734718 GTGGAACTGGGATCAAACCCAGG - Intronic
1098890440 12:76005132-76005154 GTGAACCAGGCAACAAACATGGG + Intergenic
1101718182 12:107329259-107329281 GTGGACCAGGGTTCAAATTCTGG + Intronic
1102015768 12:109646922-109646944 GAGGACCAGTGAGCAGAGACAGG - Intergenic
1104608351 12:130206103-130206125 GTGGGCCAGGGAGCAGGCAGAGG + Intergenic
1109249567 13:60002659-60002681 CTGGATCAGGGAGAAACCACAGG + Intronic
1116049103 14:39781587-39781609 GAGGAGCAGGGGGAAAACACAGG - Intergenic
1118199951 14:63662750-63662772 GTGGACCAGGGGCCATACAGGGG - Intergenic
1118791604 14:69098357-69098379 GTGGGCCAGGGAGGAAGCATTGG - Intronic
1119374992 14:74183459-74183481 GTAGGCCAGGGAGCAGAGACAGG - Intronic
1120380437 14:83771781-83771803 GTGGACCAAGGATTAAACCCTGG - Intergenic
1121260849 14:92565082-92565104 GTGGAGCAGTGAGGGAACACAGG - Intronic
1122427286 14:101619493-101619515 GTGGTCCAGGCAGAAAACTCTGG + Intergenic
1202832907 14_GL000009v2_random:56946-56968 GGGGACCAGTGAGTACACACTGG - Intergenic
1123787128 15:23685202-23685224 CTGCACCATGGAGGAAACACAGG - Intergenic
1129817057 15:78564857-78564879 GTGGACCAGCGAGACAACCCTGG - Intergenic
1130095323 15:80851228-80851250 CAGGGCCAGGGAGCAAACAAAGG + Intronic
1130686537 15:86042484-86042506 CTGGACCAAGGAGCAGCCACTGG - Intergenic
1134222575 16:12366555-12366577 TTGGACCTGGGACTAAACACAGG - Intronic
1137236876 16:46624386-46624408 GGGGAACAGGGAGCATTCACAGG - Intergenic
1143356481 17:6332813-6332835 TTGGACCAAGGTTCAAACACAGG + Intergenic
1144226829 17:13157279-13157301 GTGGAGCAAGGATGAAACACAGG + Intergenic
1144379516 17:14680406-14680428 GTAGACCTGGGACCAGACACTGG + Intergenic
1146571151 17:33954383-33954405 ATGGAGCAGTGAGCAAAAACAGG - Intronic
1150484364 17:65533528-65533550 GGGGAGCAGGGAGCAAAAAGAGG - Intronic
1151292332 17:73159548-73159570 GTGGTCCAGGAAGCACACTCTGG + Intergenic
1153397150 18:4636862-4636884 GGAGACCAGGGAGTCAACACAGG + Intergenic
1157561377 18:48648797-48648819 TGGGACCAGTGAGGAAACACAGG + Intronic
1159973906 18:74686504-74686526 CTGGATCAGGGAGCGAACAGAGG - Intronic
1161281417 19:3447766-3447788 GTGGTCCAGGGTTCAAACCCCGG - Intronic
1162218506 19:9156732-9156754 GTGCACCTGGGAACCAACACTGG - Exonic
1162303877 19:9859746-9859768 GTGGACCAGAGCTCACACACAGG + Intronic
1162415713 19:10535802-10535824 GTGGACCTGAGAACACACACAGG + Intergenic
1163386426 19:17002686-17002708 GTGGCCCTGGGAGCCAACAAGGG + Intronic
1166735296 19:45080324-45080346 GAGGAAGAGGGAGCAAACTCTGG - Intronic
1202639773 1_KI270706v1_random:70778-70800 GGGGACCAGTGAGTACACACTGG + Intergenic
925160599 2:1681037-1681059 GAGTTCCAGGTAGCAAACACAGG + Intronic
925448609 2:3950140-3950162 GAGGACCAGGGAGCAAGGTCAGG - Intergenic
926309348 2:11663348-11663370 GTGCACCAGAGAGCAACCAGTGG + Intronic
926775102 2:16414433-16414455 ATGGACCAAGGAGAAATCACAGG - Intergenic
929555290 2:42922022-42922044 GTGGGCCATGGAGCTGACACTGG + Intergenic
934131700 2:88954964-88954986 GAGGACCTGGGAGCAACCACAGG + Intergenic
934165848 2:89293527-89293549 GAGGACCTGGGAGGAACCACAGG + Intergenic
934201429 2:89888929-89888951 GAGGACCTGGGAGGAACCACAGG - Intergenic
934220351 2:90076510-90076532 GAGGACCTGGGAGGAACCACAGG - Intergenic
941658246 2:168167627-168167649 GTGGACCAGCTACCAGACACAGG + Intronic
942966050 2:181892658-181892680 GCGGACCAGGGAGCACTCACCGG - Exonic
945063210 2:205926081-205926103 AAGCACCACGGAGCAAACACCGG - Intergenic
946607788 2:221424836-221424858 GGGCACCAGGCAGCAAGCACAGG - Intronic
948739454 2:240033351-240033373 TTGGACCAGAGAGGAAACAGAGG - Intergenic
948934110 2:241150926-241150948 GTGAACCAAGGAGCAGACTCTGG - Intronic
1169675659 20:8151376-8151398 GTGGCCCTGGGACCAGACACAGG - Intronic
1173729335 20:45317656-45317678 GTGGACCAGGGAGCAAACACAGG - Exonic
1174177083 20:48651937-48651959 TTGGACCAGGGAGCTGAAACGGG + Intronic
1175172004 20:57087188-57087210 CGTGACCAGGGAGCACACACGGG - Intergenic
1176648102 21:9368378-9368400 GGGGACCAGTGAGTACACACTGG + Intergenic
1180362167 22:11911092-11911114 GGGGACCAGTGAGTACACACTGG - Intergenic
1184343947 22:43901570-43901592 CTGGACCATGGAGCAAAGACCGG - Intergenic
1184727144 22:46353784-46353806 TTGGGCCAGAGAGCAAACATAGG + Exonic
951363816 3:21756194-21756216 TTGGACCAGGGAAGAAACAGTGG + Intronic
961511190 3:127404795-127404817 ATGGAGCAGGGACCAAACCCAGG - Intergenic
961532044 3:127545912-127545934 GTGGCCCAGGTGGCAAACTCAGG - Intergenic
961749995 3:129089083-129089105 GGGGAACAGGGAGCATTCACAGG - Exonic
963043996 3:141089215-141089237 GTGGACGAGGGTCCAAACACTGG + Intronic
964374036 3:156031987-156032009 GAGGACCAAGGACCAAACCCAGG + Intergenic
967109984 3:186284592-186284614 GGGGAGCAGGGAGCAAGCAGAGG - Intronic
1202738782 3_GL000221v1_random:36609-36631 GGGGACCAGTGAGTACACACTGG - Intergenic
969925215 4:10579029-10579051 GAGAACCAGGGATCAAACTCTGG + Intronic
973370016 4:49237132-49237154 GGGGACCAGTGAGTACACACTGG + Intergenic
973391010 4:49558279-49558301 GGGGACCAGTGAGTACACACTGG - Intergenic
976103733 4:81593909-81593931 GTGCACCAGGGATGGAACACTGG + Intronic
976827371 4:89275755-89275777 GTGGACAAGGAGGCAAACAAAGG - Intronic
977716821 4:100191625-100191647 GAGGGCCTGGGAGCCAACACTGG - Intergenic
978157609 4:105507771-105507793 ATGGTCCAGTGAGCAATCACAGG + Intergenic
981062063 4:140435720-140435742 ATGGAGCAGGGAACAAACACGGG - Intergenic
983114215 4:163792848-163792870 GTGAAGCAGGGAAAAAACACTGG + Intronic
1202767129 4_GL000008v2_random:156633-156655 GGGGACCAGTGAGTACACACTGG + Intergenic
985839476 5:2295458-2295480 GTGGACCAGGGTGGAAACCTCGG - Intergenic
987266873 5:16265172-16265194 GTGGAACAGTGAACAAAGACAGG - Intergenic
988286777 5:29228887-29228909 GAGGACCAGAGAGTCAACACTGG + Intergenic
990212429 5:53494719-53494741 GTGAAGCAGGGATCAAAAACTGG + Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992157194 5:73967152-73967174 GTGGAGCAAGTGGCAAACACTGG + Intergenic
996478841 5:123950294-123950316 ATGGATCAGGGAGGAAACGCAGG + Intergenic
999949473 5:156633505-156633527 GGGGACCAGGACCCAAACACAGG - Intronic
1001307215 5:170584205-170584227 CTGGACCTGGGAGCAGCCACGGG + Intronic
1002420898 5:179148650-179148672 GAGGACCAGGAAGGAAGCACGGG - Intronic
1002481613 5:179504999-179505021 GAGGCCCAGGGTGCAAACTCAGG - Intergenic
1003467482 6:6394662-6394684 GGATATCAGGGAGCAAACACAGG + Intergenic
1003790127 6:9536962-9536984 CTGGAGCAGGGATCAAACACAGG + Intergenic
1006234880 6:32621128-32621150 GTGGACAAGGAAGCATGCACAGG + Intergenic
1008089327 6:47277441-47277463 GAGGACGAGGGTGCAAACGCTGG - Intronic
1008713405 6:54257574-54257596 GTGGTCCAGGTATCAGACACGGG - Intronic
1014695512 6:124616229-124616251 ATTGAACAGGGAACAAACACAGG - Intronic
1015946968 6:138512892-138512914 GTGGAGAAGGGAGGTAACACCGG - Intronic
1016393117 6:143594666-143594688 ATGGTCCAGGGAGCAAGCCCAGG + Intronic
1019417744 7:935115-935137 GTGGGCCAGGGAGCGAAGGCGGG - Intronic
1019513732 7:1430593-1430615 GTGGACCAGGTAGCAACCCTGGG + Intronic
1019758399 7:2790094-2790116 GTGGCAGAGGGAGCAGACACAGG - Intronic
1023883836 7:44336615-44336637 GGGGAGCACGGAGCAATCACGGG - Intergenic
1030634228 7:111930613-111930635 GTGGTCCAGAGAGAAAACAGCGG + Intronic
1031989108 7:128184639-128184661 GTGGACCAGGGACAAAAACCCGG + Intergenic
1033004586 7:137547929-137547951 GAGGACCAGAGAGCAAAACCAGG + Intronic
1033308549 7:140242241-140242263 GTGGCCCAGGGAGCCATCTCAGG - Intergenic
1035570066 8:666889-666911 GTGGACCAAGGTGCAGCCACAGG - Intronic
1037678147 8:21069974-21069996 GTGGACTAGCCAGCTAACACTGG + Intergenic
1039190672 8:34970662-34970684 GTGGACCAGGCTGCCAAAACAGG - Intergenic
1039517837 8:38148159-38148181 GTGGAGCATGGAGGAACCACAGG + Intronic
1041561710 8:59226008-59226030 GTCGACCAGGGAACACCCACAGG - Intergenic
1042525122 8:69756739-69756761 GAGCACTAGGAAGCAAACACAGG + Intronic
1042676922 8:71331807-71331829 GTTGAACTGGAAGCAAACACAGG - Intronic
1042941674 8:74114594-74114616 ATGGCCCATGGAGCAAACACTGG + Intergenic
1044901127 8:96945879-96945901 TTTGAACAGAGAGCAAACACAGG - Intronic
1047027801 8:120843489-120843511 TTGGATCAGGGAGGACACACAGG - Intergenic
1051686902 9:19667498-19667520 TTGGTCCAGGGAGCAAACATAGG - Intronic
1051807952 9:21017142-21017164 GTGGATCAAGGAGAAAAGACTGG + Intronic
1057224129 9:93278393-93278415 GTGGACCCGGGAACTCACACAGG + Intronic
1057230738 9:93319938-93319960 GTGGACCGGGCAGGAGACACTGG - Intronic
1058888046 9:109337868-109337890 GGGGAGCAGGGAGGGAACACAGG - Intergenic
1059936376 9:119315453-119315475 GTGGAGCAGTCAGAAAACACAGG - Intronic
1060240479 9:121898450-121898472 GTGGAACAGGGAGCCAGGACAGG + Intronic
1061164584 9:128914901-128914923 GCGGAGCAAGGAGCAAACAGGGG - Intronic
1061304499 9:129724592-129724614 GGGGCCCAGGGAGCACAGACGGG + Intergenic
1061445691 9:130635973-130635995 GTTGACAAAGGAGGAAACACAGG - Intronic
1203707513 Un_KI270742v1:67053-67075 GGGGACCAGTGAGTACACACTGG - Intergenic
1189063050 X:37774763-37774785 GTGGACCACTGGGCAATCACTGG + Intronic
1189232120 X:39460670-39460692 GTGGTCCAGGGAGCACTCAAGGG + Intergenic
1192229953 X:69257749-69257771 GTGGCCCAGAGAGGAAACAGAGG + Intergenic
1195259465 X:103117829-103117851 GATGGCCAGGAAGCAAACACTGG + Intergenic
1195352951 X:104011916-104011938 GTGGACCAGAGAACATACTCTGG - Intronic
1195587699 X:106584885-106584907 GTGGACCAGGAGGCAAAGAAAGG - Intergenic
1200106405 X:153715695-153715717 GTGGAGCAGAGAGGAGACACGGG + Intronic
1200108519 X:153727080-153727102 CTGACCCAGGGAGCACACACAGG - Intronic
1201951753 Y:19572809-19572831 GTGGAACAGAGAGACAACACTGG - Intergenic