ID: 1173729394

View in Genome Browser
Species Human (GRCh38)
Location 20:45317959-45317981
Sequence CGTTTTCTAGAGGAGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173729389_1173729394 -10 Left 1173729389 20:45317946-45317968 CCTACCTTTTGGACGTTTTCTAG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1173729394 20:45317959-45317981 CGTTTTCTAGAGGAGGAACAGGG 0: 1
1: 0
2: 0
3: 14
4: 221
1173729387_1173729394 14 Left 1173729387 20:45317922-45317944 CCACAAGTCTGATGGAGCAGAGA 0: 1
1: 0
2: 2
3: 28
4: 311
Right 1173729394 20:45317959-45317981 CGTTTTCTAGAGGAGGAACAGGG 0: 1
1: 0
2: 0
3: 14
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173729394 Original CRISPR CGTTTTCTAGAGGAGGAACA GGG Intergenic
901876669 1:12170565-12170587 TGTTTTCTGGAGGAGTAGCAGGG + Intronic
902380125 1:16048851-16048873 CATTTTGTAGAGGAGGAAGCCGG - Intronic
902791329 1:18770206-18770228 CATTTTATAGAGGAGTAACCAGG + Intergenic
904129471 1:28265059-28265081 CATTTTACAGATGAGGAACAAGG - Intronic
904516919 1:31063235-31063257 CATTTTCTAGATGAGGAAACAGG - Intronic
905439074 1:37981906-37981928 TGTTTTCTAAAGAAGTAACAAGG + Intronic
907399091 1:54213401-54213423 TCTTTTCTAGAGGAGGAATGAGG + Intronic
907792333 1:57679094-57679116 CATTTTCTAGAGAATGAATATGG + Intronic
912640728 1:111342976-111342998 GGTTTTCTAGAGAAGGCAAAGGG + Intergenic
913334307 1:117694817-117694839 CATTTTCAAGAGGAAGAATAAGG + Intergenic
916267708 1:162907505-162907527 CCTTTTACAGAGGAGGAAAATGG - Intergenic
916533902 1:165685181-165685203 GGTGATATAGAGGAGGAACAGGG - Intronic
917115901 1:171603261-171603283 CATTTGCTCGGGGAGGAACAAGG - Intergenic
918652915 1:186987940-186987962 CTTTTCCTAGTGGAGGAAGAAGG - Intronic
918912869 1:190595994-190596016 AGTTTTCTAGAGGAGGGAAGAGG - Intergenic
918944498 1:191045069-191045091 CATTTTATAGATGAGGAACCTGG + Intergenic
918961863 1:191289440-191289462 CGTACTCAAGAGGAGGAGCAAGG + Intergenic
920003643 1:202816566-202816588 CATTTTATAGATGAGGAACTGGG + Intergenic
921179106 1:212617582-212617604 CCTTTTCTACAGGAGCATCATGG + Intronic
921950111 1:220920790-220920812 GGTTTTCTGGAGCAGGAATAAGG - Intergenic
923854312 1:237829335-237829357 CTTTTGCTAGAGGTGGCACATGG + Intronic
923908167 1:238409189-238409211 CGTTATCTACAGGAGTAACTGGG - Intergenic
924091017 1:240500849-240500871 GTTTTTCTAGAGGAGGCACCGGG + Intronic
1063180718 10:3596622-3596644 CAGTTTCTAGAGGAGGAAACGGG - Intergenic
1067568631 10:47355693-47355715 CGTTTTCTAGAGGAAAAAAAAGG + Intronic
1069445320 10:68467979-68468001 CATTTTATAGATGAGGAAAATGG - Intronic
1071369600 10:84937900-84937922 AGTTTCCTAGAGAAGTAACAGGG - Intergenic
1073320758 10:102615010-102615032 CTTTTTACAGAGGAGGAACTGGG - Intronic
1073606691 10:104902650-104902672 TATTTTCCAGAGGAGAAACAGGG + Intronic
1073680588 10:105699190-105699212 AGATTTCTGGAGAAGGAACATGG + Intergenic
1076290731 10:129343551-129343573 CGGTTTCTGGAGGGGGCACAGGG - Intergenic
1078529763 11:12127938-12127960 CGTTTTCAAGAGGATGAAGTGGG + Intronic
1079315717 11:19406422-19406444 CGTTTTCCAGAAGAGGAAAAGGG + Intronic
1081493270 11:43582878-43582900 CGTTTTCTAAAAGAGTAAAAAGG + Intronic
1081937309 11:46913891-46913913 CGTTTTCAAGGGGAGAAAGAAGG + Intronic
1083011926 11:59409822-59409844 GGTTTTATAAAGTAGGAACAAGG - Intergenic
1085284294 11:75350115-75350137 CATTTTCTAGAGGAGGAAACAGG - Intronic
1085783026 11:79426415-79426437 CATTTTCCAGAGGGGCAACAGGG - Intronic
1087842268 11:102932690-102932712 CCTTTTCTCGAGGAGGAATTGGG + Intergenic
1089148256 11:116346077-116346099 CATTTTATAGAGGAGGATCTAGG - Intergenic
1091472068 12:737577-737599 CGTTTTATAGATGAGGGAAAAGG + Intergenic
1091509436 12:1107233-1107255 CCTTTACCAGTGGAGGAACAGGG + Intronic
1093182147 12:15978956-15978978 CATTTTGTAAATGAGGAACATGG + Intronic
1093820569 12:23612783-23612805 TGTTTTTAAGAGGAGGAACAGGG + Intronic
1093837585 12:23854497-23854519 CATTTTCTAGATGAGGAAACAGG - Intronic
1096881075 12:54671478-54671500 TGTTTTCTAGTTGAGGACCAGGG - Intergenic
1100293975 12:93243689-93243711 TGTGGTCTAGAGGAGAAACACGG - Intergenic
1101252142 12:102946863-102946885 GGTTTTGTAGAGGAGCAATAGGG + Intronic
1102208110 12:111104594-111104616 CATTTTATAGATGAGGAACCAGG - Intronic
1103002157 12:117393344-117393366 CATATTCCAGAGGAGGAAAAAGG + Intronic
1103532333 12:121611290-121611312 CGTTTTCTAGATGGGGAATCTGG + Intergenic
1103968163 12:124653146-124653168 CATTTTATAGAGGAGGAAACAGG - Intergenic
1104711478 12:130989875-130989897 CTTTCTGTAGAGGAGGAAGAAGG + Intronic
1106206500 13:27601176-27601198 CATTTTATAGATGAGGAAAACGG + Intronic
1106740156 13:32631919-32631941 AAATTTCTAGAGGAGGAACCAGG + Intronic
1108343267 13:49518639-49518661 CATTTTCCAGAGGAGGAAACTGG + Intronic
1108759323 13:53543725-53543747 CATTTTATAGATGAGGAACCTGG - Intergenic
1110708295 13:78621001-78621023 TGCCTTCTTGAGGAGGAACAAGG + Intronic
1111611881 13:90616063-90616085 CGTTTTCTAGTGTAGCCACAAGG + Intergenic
1113173355 13:107531936-107531958 TGTTTTCTAGATGACTAACATGG + Intronic
1116240406 14:42335017-42335039 AGTGTTGCAGAGGAGGAACATGG - Intergenic
1116314851 14:43373684-43373706 CGAATTCTAGAAGAGGTACAAGG + Intergenic
1117283933 14:54267731-54267753 CAATTTATAGAGGAGGAACATGG + Intergenic
1117354266 14:54908519-54908541 CATTTTACAGAGGAGGAACCAGG - Intergenic
1119037891 14:71246068-71246090 CCTTTTCTAGCTGAGGAGCATGG + Intergenic
1119137169 14:72231763-72231785 CGTGTTCGAGAGAAAGAACATGG + Intronic
1121573672 14:94966286-94966308 CATTTTCTGGAGGAGGAAACAGG + Intergenic
1121636154 14:95455174-95455196 CATTTTCTAGATGAGGAAGCTGG - Intronic
1122071056 14:99205581-99205603 CCTTTTCCAGAGGAGGAAAAAGG + Intronic
1122267993 14:100555553-100555575 CGTTTTCCAGATGAGGAAACAGG + Intronic
1127354213 15:58182632-58182654 ATTTTTCTAGGGGAGGCACATGG - Intronic
1129552061 15:76462994-76463016 CGTTTTATAGATGAGGATAATGG - Intronic
1130263088 15:82374936-82374958 CGTATGCTCGAGGATGAACAAGG + Intergenic
1130278204 15:82494727-82494749 CGTATGCTCGAGGATGAACAAGG - Intergenic
1130470533 15:84221912-84221934 CGTATGCTCGAGGATGAACAAGG - Intergenic
1130478021 15:84336479-84336501 CGTATGCTCGAGGATGAACAAGG - Intergenic
1130493744 15:84451651-84451673 CGTATGCTCGAGGATGAACAAGG + Intergenic
1130592820 15:85226538-85226560 CGTATGCTCGAGGATGAACAAGG - Intergenic
1131901617 15:97094226-97094248 CATTTTATAGAGGAGGACAATGG - Intergenic
1132266124 15:100472422-100472444 CATTTTCTAAGGGAGGAAGAGGG - Intronic
1132611290 16:817517-817539 CTTTTTCTAGGGGAGGAAACAGG - Intergenic
1134031117 16:10993089-10993111 CGTTTTATAGAAGATGAACCTGG + Intronic
1134046571 16:11105335-11105357 CGTATTGAAGAAGAGGAACAAGG + Intronic
1136586502 16:31189588-31189610 CATGTTCTAGAGGAAGAAGATGG + Intronic
1137841881 16:51648643-51648665 GTTTTTCTGGAGCAGGAACAAGG + Intergenic
1140879629 16:79186332-79186354 AGTTCTCTAGAGAAGGAGCATGG - Intronic
1141943365 16:87293444-87293466 CATTTTCTAGATGAGGAAATGGG - Intronic
1148543039 17:48495065-48495087 CATTTTGTAGAAGAGGTACAAGG - Intergenic
1148749964 17:49940059-49940081 CCTTTTCTTGAGCAGGAACTTGG + Intergenic
1149547727 17:57516903-57516925 CATTTTCTAGAGGAGCAAACTGG - Intronic
1151951033 17:77354248-77354270 CGTTTTATAGATGAGGAAACAGG + Intronic
1155279758 18:24227579-24227601 AGTTTTCTGGAGTAGGCACAGGG + Intronic
1157668695 18:49510531-49510553 CGTTTTACAGAGGATGAACTTGG + Intergenic
1159651169 18:70981148-70981170 TGTTTTATACAGGAGGAACTTGG + Intergenic
1160232780 18:77060806-77060828 TGTTTTCTGGAGGAGGAAACAGG + Intronic
1163283566 19:16332122-16332144 CATTTTCTAGAGGTGGAAAGTGG + Intergenic
1164467866 19:28503261-28503283 CGTGTTCTCCAGGAGGAGCAAGG + Intergenic
1167437742 19:49489683-49489705 CGTTCTACAGATGAGGAACAGGG - Intronic
1167529379 19:50005472-50005494 CATTTTATACATGAGGAACATGG - Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925781220 2:7383462-7383484 TGTTTTCTAGATGAGGAAACTGG - Intergenic
926884505 2:17584883-17584905 TGTTTTCTAGAGGAGGCCCAAGG - Intronic
927206194 2:20612143-20612165 CATTTTATAGAGGAGGAAATTGG + Intronic
927340456 2:21977962-21977984 GGGTTTCTAGGGGAGGAACCTGG + Intergenic
932209693 2:69916111-69916133 TGTTTTCTAGAAGCTGAACATGG + Exonic
933686185 2:85143181-85143203 TCTATTCAAGAGGAGGAACAAGG + Intronic
937005843 2:118513178-118513200 CATTTTATAGAGGAGGAAACTGG + Intergenic
937364521 2:121251523-121251545 CAATTTCTTGTGGAGGAACAGGG + Intronic
938324965 2:130392177-130392199 CGTTTTCTGGATGAGAAAAATGG - Intergenic
940336591 2:152535269-152535291 AGTTTTCCAGATCAGGAACATGG - Intronic
940363153 2:152817415-152817437 CGTTGTTTAGAGGAGCAACTTGG + Intergenic
940413807 2:153397041-153397063 CGTATTTTAGAGGATGAAAATGG - Intergenic
940689410 2:156896631-156896653 CTTTTTCTAGAGGAGATCCATGG - Intergenic
943529426 2:189060556-189060578 CATTTTGTAGATGAGGAAAATGG - Intronic
946428207 2:219611107-219611129 TGTTTTATAGACGAGGAACCAGG + Intronic
946483326 2:220077206-220077228 TGTTTTTTAAAGAAGGAACATGG - Intergenic
948032270 2:234828585-234828607 CGTTATCTACAGGAGCAACTAGG + Intergenic
948082829 2:235220459-235220481 CGTTTTCCAGGTGAGGGACATGG + Intergenic
1170971158 20:21117725-21117747 CGTTTTCCAGATGAGGAATTTGG - Intergenic
1173729394 20:45317959-45317981 CGTTTTCTAGAGGAGGAACAGGG + Intergenic
1175290169 20:57870229-57870251 CATTTTATAGATGAGGAACGTGG + Intergenic
1176229205 20:64023086-64023108 CATTTTCTAGCTGAGAAACAAGG + Intronic
1179461079 21:41535836-41535858 TGTTTTCCAGAGGAAGCACAGGG + Intergenic
1181610346 22:24007543-24007565 CGTTTTACAGAGGAGAAACCTGG + Intergenic
1182094163 22:27614872-27614894 AGTTTTCTAGATGAGGAAACTGG - Intergenic
1183010684 22:34944242-34944264 CCTTCTCTAGTGGAGGAACCAGG - Intergenic
1183023347 22:35044940-35044962 CCTTTTCCAGAGGAGGAAACTGG - Intergenic
1184397264 22:44249680-44249702 CGTTTTCTGGAGGAAATACAAGG + Exonic
949325443 3:2858245-2858267 CTTATTCTGGAGGTGGAACAGGG - Intronic
951185911 3:19712852-19712874 CGTATTTTAAAGGATGAACAGGG + Intergenic
952421416 3:33134919-33134941 CGCTTTATAGATGAGGAGCATGG + Intronic
952639367 3:35573900-35573922 CTTTTTATAAAGGAGGAAAAAGG + Intergenic
954142880 3:48619320-48619342 CTTTTTCTAAAGCAGGAACCTGG + Intergenic
955221731 3:57028730-57028752 CGTTTTACAGATGAGGAAAAAGG - Intronic
955664966 3:61340403-61340425 CATTTTCTAGATGAGGAAAATGG + Intergenic
955983741 3:64552123-64552145 CGTTTTCCAGATGAAGAAAATGG + Intronic
959372639 3:105547698-105547720 ATTTTCCTAGAGGAAGAACATGG + Intronic
960850511 3:122048021-122048043 CTTTTCCTTGATGAGGAACAAGG - Intergenic
961044777 3:123700871-123700893 GGTTGGCTAGAGGAGGAAGACGG - Exonic
963215267 3:142739293-142739315 CATTTTATAGAGGAGGAAACAGG + Intronic
964208079 3:154196760-154196782 GCTTTCCTAGAGGAGGAACTGGG + Intronic
965403053 3:168236499-168236521 GGTTTTCTAGAGGAAGAAGCAGG + Intergenic
966718871 3:183040964-183040986 TGTTTTCTAGATGAGGAAACTGG - Intronic
967225911 3:187291271-187291293 CTCTTTCCAGAGGAGGAACACGG + Intronic
967367597 3:188705405-188705427 CATATTTGAGAGGAGGAACAAGG - Intronic
969086128 4:4657881-4657903 CATTTTATAGAGGAGGACCCTGG + Intergenic
970842481 4:20490793-20490815 TGTTTTCTAGATGAGGAAGAAGG + Intronic
972661233 4:41118386-41118408 CATTTTATAGATGAGGAAAACGG - Intronic
972708292 4:41567629-41567651 CATTTTATAGATGAGGAACCTGG + Intronic
976293966 4:83451258-83451280 CTTTTTATAGATGAGGAACTAGG + Intronic
976482961 4:85565986-85566008 TGTTTTCCAGAGGAGGAAACTGG - Intronic
977299842 4:95255288-95255310 TGTGTTCTTGAGGTGGAACATGG + Intronic
978187132 4:105869524-105869546 AGTTTTCTTGAAGAGGCACATGG + Intronic
978545864 4:109872450-109872472 CCATTTCTACAGGAGGATCAAGG + Intergenic
982296663 4:153835981-153836003 CGTTTACAAGAGGAGGAAAGAGG - Intergenic
982700244 4:158653421-158653443 AGTTTTCTACATGAAGAACATGG + Intergenic
985196892 4:187440802-187440824 CATTTCCCTGAGGAGGAACATGG - Intergenic
986451964 5:7874537-7874559 CCTTTTGTAGAGAAAGAACATGG + Intronic
991989311 5:72321355-72321377 CCATTTACAGAGGAGGAACAAGG + Intronic
992077676 5:73206143-73206165 CTTTTTATAGAGGAGGAAACAGG - Intergenic
992753276 5:79880680-79880702 CCTTTTCTAGAATAGCAACATGG + Intergenic
995596038 5:113748688-113748710 GGTTTTATAAAGTAGGAACAAGG - Intergenic
996548184 5:124703454-124703476 TGTTTTCTAGTTGAGGAAAATGG - Intronic
997172475 5:131737404-131737426 AGTTTGCTAGAGGAAGAAAAGGG - Intronic
997557288 5:134811372-134811394 TGATTTCTAGAAGAGTAACATGG - Intronic
998471256 5:142385797-142385819 CATTTTCAAGAGGAGGAAAGTGG - Intergenic
999035777 5:148347676-148347698 CATTTTATAGAGGAGGAAATTGG - Intergenic
999711115 5:154319500-154319522 CATTTTCCAGATGAGGAAAATGG - Intronic
1000722881 5:164730334-164730356 CATTGTCTAGAGGAGGCAGAGGG + Intergenic
1000832266 5:166117462-166117484 AGTTTTGAAAAGGAGGAACAAGG + Intergenic
1001474589 5:172041425-172041447 CATTTTCTAGATGAGGAAATGGG - Intergenic
1003298886 6:4858813-4858835 CTTTTTCCAGAGGAGGAACTGGG - Intronic
1004190413 6:13458607-13458629 CATTTTGTAGAAGAGGAAAATGG - Intronic
1006480573 6:34290061-34290083 TGTTTTATAGATGAGGAAAATGG - Intronic
1007756772 6:44104549-44104571 GGTTTTCCAGATGAGGAACTGGG + Intergenic
1010351754 6:74883195-74883217 TGTGTTCCAGAGGAGGGACAAGG - Intergenic
1011170619 6:84500638-84500660 CATATTCTAGTGGAGGGACAGGG - Intergenic
1011376836 6:86696306-86696328 ACTTTTCTAGAGTTGGAACATGG - Intergenic
1012437068 6:99226126-99226148 CTTTTTTTAAAGGAGGAAAAAGG + Intergenic
1014758012 6:125323224-125323246 CATTTTGTAGAGGATGAAGAAGG + Intergenic
1014835655 6:126157382-126157404 GGCTTTCTTGAGGAGGAAAAGGG - Intergenic
1015604078 6:134937801-134937823 TCTTTTGTAGGGGAGGAACATGG + Intronic
1016045874 6:139479892-139479914 AGTCTTCTAGAAGAGGAGCATGG + Intergenic
1019009033 6:168826349-168826371 CGTTTTCTAGCTCAGGAAAATGG - Intergenic
1019451673 7:1101851-1101873 CGTTTTCTGGAGGCCGAGCAGGG - Intronic
1020145684 7:5640550-5640572 AGTATTTTAGAGGAGGAGCAAGG - Intronic
1022238171 7:28482557-28482579 AGGTTTCTAGAGGAGGAAACTGG - Intronic
1024100279 7:46025305-46025327 CGTTTTCTAGGGTTGGGACAGGG - Intergenic
1024458397 7:49634489-49634511 CATTTTCTAGATGAGGAAACAGG - Intergenic
1024464923 7:49702122-49702144 CATTTTCTAGACAAGGAAAACGG - Intergenic
1027171099 7:75873124-75873146 AGTTTTCTATAAGTGGAACATGG - Intronic
1028782809 7:94756909-94756931 AGTTTGCTGGAGGAGGGACAAGG + Intergenic
1028989768 7:97036400-97036422 CGTTTTTTAGTGTTGGAACAAGG + Intergenic
1031085573 7:117298843-117298865 CATTTTATAGATGAGGAACCAGG + Intronic
1031126624 7:117781038-117781060 CCTTTTATAGAGAAGGCACATGG - Intronic
1031919695 7:127591547-127591569 CCTCTTCCAGAGGAGGAGCAGGG + Exonic
1032982883 7:137305229-137305251 CATCTTGTGGAGGAGGAACATGG - Intronic
1034886230 7:154801151-154801173 CGTTTTCTAAAAGAAGAAGATGG - Intronic
1037313125 8:17577119-17577141 CGGTTTCTTCAGGAGGAACAAGG - Exonic
1039906411 8:41789762-41789784 CGCTTTCTAGATGAGGAAACAGG - Intronic
1040732154 8:50461224-50461246 GGTTTTCCAGAGGAAGACCACGG + Intronic
1041500863 8:58536834-58536856 GGTTTTCTTGGGGAGGGACAGGG + Intergenic
1042170832 8:65989428-65989450 GGTTTTCTAGAGAGGGGACATGG + Intergenic
1042839678 8:73111140-73111162 CATTTTATAGAGGAGGAAACTGG + Intronic
1044590095 8:93905964-93905986 TGCTTTATAGATGAGGAACAGGG - Intronic
1044690011 8:94868152-94868174 CTTTTTTTAGGGGAGGAAAAAGG + Intronic
1045396515 8:101765952-101765974 AGTTTTCTATATGAGAAACAAGG - Intronic
1045871057 8:106927523-106927545 AGATTTCTAGAAGTGGAACATGG + Intergenic
1046295334 8:112211992-112212014 TATTGTGTAGAGGAGGAACAAGG + Intergenic
1046793976 8:118350468-118350490 CATTTTATAGAGAAGAAACAAGG - Intronic
1048305715 8:133283173-133283195 CATTTTGTAGAGGAGGAAGTTGG - Intronic
1048469205 8:134692160-134692182 CATTTTCTAGAAAAGGAAGATGG + Intronic
1048510297 8:135055850-135055872 CACTTTCTAGAGGAAGCACAAGG - Intergenic
1056065394 9:82928356-82928378 GGCTTTCTAGTGGAGGGACATGG - Intergenic
1056852746 9:90097908-90097930 CATTTTATAGAGGAGGAAGTGGG + Intergenic
1057421400 9:94915880-94915902 CTTTTTCCAGACAAGGAACATGG + Intronic
1057757618 9:97850351-97850373 CAGTTTCTTGAGAAGGAACATGG - Intergenic
1058621187 9:106884880-106884902 CGTTGGCTAGAGGATCAACACGG + Intronic
1059155189 9:111983282-111983304 GGTTTTCTGGAGGAGGAAGATGG + Intergenic
1060246326 9:121949706-121949728 GGTTTTCTAAAAGTGGAACAGGG - Intronic
1060832816 9:126728458-126728480 AATTTTAAAGAGGAGGAACAAGG - Intergenic
1061309262 9:129751779-129751801 TGTTTTCTAGGTGAGGAACCTGG - Intronic
1061926643 9:133809133-133809155 CATTTTCTAGAGGAGGGAAGGGG + Exonic
1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG + Intergenic
1187031762 X:15495269-15495291 AGTTTTACAGAGGAGGAAAATGG - Intronic
1187541240 X:20197520-20197542 CATTTTATAGAGGAGGAAACAGG - Intronic
1187987080 X:24825729-24825751 CCTTTTCTTGAGGAGGAACCAGG + Intronic
1189675991 X:43461119-43461141 CGTTTTCTAGGGGAGTCACTGGG - Intergenic
1192560208 X:72123385-72123407 GGTTTTGTAGAGGAGCAGCAAGG + Intergenic
1193560424 X:83010909-83010931 AGTTTTCTTGAGGAGGAAAGTGG + Intergenic
1193810571 X:86046335-86046357 CATTTTGTAGAAGAGGAAAAGGG - Intronic
1195762443 X:108261446-108261468 CATTTTATAGATGAGGAAAATGG + Intronic
1198239292 X:134767354-134767376 TTTCTTCTAGAGGAGGCACATGG - Intergenic
1199968767 X:152843193-152843215 CGTTTGCTAGAGGAGGATGTAGG - Intronic
1200972783 Y:9174710-9174732 TGTTTGCTAGCTGAGGAACAAGG + Intergenic
1202138235 Y:21689491-21689513 TGTTTGCTAGCTGAGGAACAAGG - Intergenic