ID: 1173732154

View in Genome Browser
Species Human (GRCh38)
Location 20:45336531-45336553
Sequence TCACTTCTTTTTACAGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173732152_1173732154 7 Left 1173732152 20:45336501-45336523 CCTGTTTTAATAACTCTGGAGGC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1173732154 20:45336531-45336553 TCACTTCTTTTTACAGCCGAGGG 0: 1
1: 0
2: 3
3: 5
4: 111
1173732150_1173732154 8 Left 1173732150 20:45336500-45336522 CCCTGTTTTAATAACTCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1173732154 20:45336531-45336553 TCACTTCTTTTTACAGCCGAGGG 0: 1
1: 0
2: 3
3: 5
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173732154 Original CRISPR TCACTTCTTTTTACAGCCGA GGG Intronic
901042057 1:6370208-6370230 CCACTTCTACTTACAGCAGAAGG - Intronic
904075779 1:27841142-27841164 TCATCTCCTTTCACAGCCGATGG - Exonic
904398854 1:30242359-30242381 TCATTTCTTTTTACAGCCCAAGG - Intergenic
905129169 1:35739940-35739962 TCTCTTCATTTTACAGTTGAGGG + Intronic
907064338 1:51465253-51465275 TTACTTACTTTTACAGCCCATGG + Exonic
909568836 1:77085333-77085355 TCAATTCTTTATCCAGCAGAGGG + Intergenic
911548933 1:99255773-99255795 GCACTTCTTGTTGGAGCCGATGG + Intergenic
913396150 1:118375103-118375125 TCACTTCTCTATACAGCCTTGGG + Intergenic
916341775 1:163744956-163744978 TCTCTTCTTTTTACAGGCAGAGG + Intergenic
917265448 1:173216271-173216293 TCCCTTCTTTCTCCAGCCCAGGG + Intergenic
923166071 1:231363414-231363436 CCACTTCCTTTTGCAGCAGAGGG + Intergenic
1064652724 10:17525698-17525720 TCAATTCTTTTTACTGGAGAAGG + Intergenic
1071734599 10:88284066-88284088 TCACTTATTTTGAAAGCAGAGGG - Intronic
1073175906 10:101557602-101557624 TCAAGTCTTTTCACAGCTGAGGG - Intergenic
1079160762 11:17991527-17991549 TCCCTTCCTTTTACAGAAGAAGG - Intronic
1079278024 11:19059853-19059875 TGACTTTTTTTTTCAGCCAAAGG + Intronic
1081064411 11:38523024-38523046 TAACTTCTATTTTCAGCCAAGGG + Intergenic
1086872645 11:92057264-92057286 TCACTTTTTTTTACAGAACATGG - Intergenic
1091285377 11:134405764-134405786 TCCCTTCTTTTCACAGATGAGGG - Intronic
1091852934 12:3714982-3715004 TTACTTCTCTTTACAGCTGAGGG + Intronic
1095886835 12:47197280-47197302 TGACTTTTTTTTACAAGCGAGGG - Intronic
1097622425 12:61956718-61956740 TCAATTCTTTTACCAGCAGATGG + Intronic
1097935991 12:65251686-65251708 TTCCTTCTTTTGACAGCCGCAGG - Intergenic
1098881700 12:75924098-75924120 CCACTTCTTTATACAGCTGCTGG - Intergenic
1099684482 12:85867099-85867121 TCACTTCTTTTCTCAGGGGAAGG - Intergenic
1102284012 12:111640475-111640497 TCACTTCTCTTGGCAGCAGAAGG - Intergenic
1102313108 12:111862732-111862754 CAACTTATTTTTACATCCGAGGG + Intronic
1107052009 13:36060900-36060922 TCACTTTTTCTTCCAGCCTATGG - Intronic
1107728269 13:43321876-43321898 TCTCTTCTTTGTACAACCTAAGG + Intronic
1111873910 13:93869139-93869161 CCCTTTCTTTTTACAGCCCACGG + Intronic
1112339022 13:98537426-98537448 TCACTTGTTTATTCAGCTGATGG - Intronic
1113808908 13:113125822-113125844 TCAAGTCTTTTTCCAGCGGAGGG + Intronic
1116189425 14:41645096-41645118 TAACTTCATTTTACAGTTGAAGG - Intronic
1118293912 14:64550905-64550927 TCATTTCGTTTTACAGCAGTTGG + Exonic
1118740318 14:68734748-68734770 TCACTTCTATTTACAGTATACGG - Intergenic
1124623864 15:31297159-31297181 TCACATCTTTTACCAGCCAAGGG - Intergenic
1131237175 15:90706698-90706720 CCACTTCTATTTACAGCCTGGGG - Intergenic
1131303731 15:91222807-91222829 TCATTTATTCTTACAGCCAATGG - Intronic
1131806494 15:96127488-96127510 TTACTTCATTTTACATCAGAAGG - Intergenic
1140122629 16:72096739-72096761 TCACTTGTTTGGACAGCCAAAGG + Intronic
1148319014 17:46733393-46733415 TCATGTCATTTTACAGCCCAAGG - Intronic
1148824814 17:50384829-50384851 TCACTTTTTTTTAGAGGTGAGGG - Intronic
1151314451 17:73312855-73312877 TCACTTCCTTTAAAAACCGAGGG - Intergenic
1152024062 17:77797321-77797343 TAACTTCTTTCTTGAGCCGATGG + Intergenic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1157002392 18:43542411-43542433 TCACTTCTTTCTGCGGTCGATGG + Intergenic
1158112515 18:53956395-53956417 TCACTGCTTTTCACAACCAATGG + Intergenic
1160277832 18:77454811-77454833 TGACTTATTTTCACAACCGAGGG + Intergenic
1160336527 18:78045624-78045646 TCACTTCCTTTTAAAGATGAAGG + Intergenic
1163513683 19:17750345-17750367 TCACTTCTTTTAAAATCCAAAGG + Intronic
1166623316 19:44325110-44325132 TGCTTTCTTTTCACAGCCGAAGG - Intergenic
925365378 2:3307681-3307703 TCACTTCTTTTCCCAGCCTCTGG - Intronic
925859451 2:8160657-8160679 GTATTTCTTTTTACAGCAGAGGG - Intergenic
926627120 2:15101285-15101307 TCACTTTTTTTTACTGCCCCTGG - Intergenic
927717504 2:25362025-25362047 TCGCTGGTTTTTGCAGCCGATGG - Intergenic
928392657 2:30921207-30921229 CCACTTCTTTATGCAGCCAAAGG + Intronic
934674507 2:96240078-96240100 TCATTTCTCATTACAGCGGAGGG + Intergenic
935643571 2:105313322-105313344 CCACTTCTTTTCACAGCACAAGG + Intronic
936912254 2:117604992-117605014 GCCCTTCCTTTTACAGTCGAGGG - Intergenic
937509034 2:122572271-122572293 TCACTTCTTTTTTCATCCTAGGG + Intergenic
941294122 2:163714929-163714951 TCATTTTTATTTATAGCCGATGG + Intronic
944892028 2:204127653-204127675 TCAAATCTTTTTAAAGCAGAGGG - Intergenic
1168834363 20:868163-868185 TCAGTTGTTTTTATAGCCTATGG + Intergenic
1173732154 20:45336531-45336553 TCACTTCTTTTTACAGCCGAGGG + Intronic
949949752 3:9219451-9219473 TCACCTCTATTTACAGATGAGGG + Intronic
953553510 3:43923806-43923828 TGGCTGCTTTGTACAGCCGAGGG - Intergenic
954417309 3:50399638-50399660 TCCCCTCCTTTCACAGCCGAGGG + Intronic
955873351 3:63463143-63463165 TCACTTTCTTTTACAGTCGAGGG + Intronic
956034078 3:65071783-65071805 TCATTTCATTTTTCAGCAGATGG + Intergenic
963698995 3:148600417-148600439 TCACTTGATTTTACAGCCCCTGG + Intergenic
964466759 3:157001329-157001351 TCACTTCTTTTAACAGAGGCAGG + Intronic
967897104 3:194406054-194406076 TGTCTTCTTTCTACAGCCCAGGG + Exonic
970303879 4:14710576-14710598 TCACTTCTGTTTACAGCCAATGG + Intergenic
975184029 4:71380322-71380344 TCACTCCTTATTACAGATGAAGG + Intronic
975478615 4:74852330-74852352 TCCCTCCTTTTTACAGAGGAGGG - Intergenic
976876513 4:89859939-89859961 TCACATATTTTTACAGCACATGG - Intergenic
977187826 4:93962416-93962438 TCACTTTTTTTTACAGGTGGGGG + Intergenic
981856214 4:149296176-149296198 TGACTTCTTTTTCCAGCCTTTGG + Intergenic
982939981 4:161538294-161538316 TCCCTTCTTTTTTCAGCAAATGG - Exonic
985862418 5:2482989-2483011 TAATTTCTTTTTACAGACAATGG + Intergenic
986537485 5:8805879-8805901 TCCCTTCTGTTTGCAGCCTAGGG + Intergenic
987851166 5:23356724-23356746 TCACTTCTTTTTGCAGTGGAGGG - Intergenic
990552904 5:56901885-56901907 TTACATTTTTTTACAGTCGATGG + Intergenic
993512100 5:88783305-88783327 TAACCTCTATTTACAGACGATGG + Intronic
993845206 5:92933304-92933326 TCCCTTCTTTTTACAGATGAGGG - Intergenic
996849533 5:127936907-127936929 TCACTTCCTGTTACAGATGAGGG + Intergenic
999228142 5:150044525-150044547 TCACAACTTTTTACAGTGGAGGG + Intronic
1004761005 6:18665789-18665811 TAACTTTTTATTACAGCCTATGG - Intergenic
1005845541 6:29774246-29774268 TCACTCATTTTTACTGCTGAAGG - Intergenic
1007262872 6:40575886-40575908 TTACTTCATTTTACAGGTGAAGG - Intronic
1008375950 6:50792093-50792115 TCACTTCCTCTTCCAGCAGAGGG - Intergenic
1009321914 6:62301895-62301917 TTACTACTTTTTACTGCCTATGG - Intergenic
1011624486 6:89271988-89272010 TCACCACTTTTTACATCCCAGGG + Intronic
1014141014 6:117942111-117942133 TCACATCTTTTTACAGACATTGG + Intronic
1016591036 6:145743408-145743430 TCTCTTCTTCTTCCAGCTGATGG - Intergenic
1017959623 6:159210382-159210404 TCACTTCTTTGGTCAGCAGATGG + Intronic
1020627655 7:10601822-10601844 TCATTTCAATTTGCAGCCGAGGG + Intergenic
1026057920 7:67000920-67000942 TTGCTTCATTTTACAGTCGAAGG + Intronic
1026720177 7:72824115-72824137 TTGCTTCATTTTACAGTCGAAGG - Intronic
1026758792 7:73111085-73111107 TCTCTTCCTTTTCCAGCCAAGGG + Intergenic
1032092957 7:128920869-128920891 TTACTTCATTTTACAGATGAAGG - Intergenic
1032344867 7:131108062-131108084 TCACTTGTTTTTGTAGCCGTGGG + Intergenic
1034590572 7:152134705-152134727 TCCCTTCTTTATTCAGTCGAAGG + Intergenic
1035899471 8:3443162-3443184 TCACATTTTTTTGCAGCAGAAGG - Intronic
1038131931 8:24742003-24742025 CCACTTCTTTTTGCAGCAGTTGG - Intergenic
1042612895 8:70617525-70617547 ACACTTCTTTTTACACCAAAAGG + Intronic
1048829242 8:138459938-138459960 TCTATTCATTTTACAGCTGATGG - Intronic
1049517795 8:143071026-143071048 TCACTTGTTTTTACATGTGATGG + Intergenic
1050268069 9:3912093-3912115 TCACTCCATTTTACAGAGGAAGG - Intronic
1052029078 9:23608282-23608304 TCACTTCTGTCTACAGATGATGG - Intergenic
1052212198 9:25918587-25918609 TCACTTCATTTTGCTGCCCAAGG + Intergenic
1057299987 9:93872364-93872386 TCAGCTCTTTTCACAGCCCATGG - Intergenic
1059949521 9:119447770-119447792 TCACTGATTTTTACAGCCTTAGG - Intergenic
1186579395 X:10801159-10801181 TGACTACTTTTTAAAGCCAAGGG - Intronic
1186863454 X:13695770-13695792 TCACTGGTTTTTATAGCCCAGGG + Intronic
1188102918 X:26112799-26112821 TCACTTTTTTTTACATCCTCTGG - Intergenic
1191690046 X:63930202-63930224 TCACTTCACTTTACAGATGATGG - Intergenic
1192086213 X:68100069-68100091 TAACTTCATTTTACAGATGAGGG - Intronic
1195116438 X:101703667-101703689 TCACTTCTCTTTCCAGCCTCTGG - Intergenic
1197408919 X:126091951-126091973 TCACTGCTTTTTCCAGCCTCTGG - Intergenic