ID: 1173734620

View in Genome Browser
Species Human (GRCh38)
Location 20:45350530-45350552
Sequence TAGGCCCCCCTGCAATTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173734620_1173734622 17 Left 1173734620 20:45350530-45350552 CCACAAAATTGCAGGGGGGCCTA No data
Right 1173734622 20:45350570-45350592 TAGATCATTAAATATAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173734620 Original CRISPR TAGGCCCCCCTGCAATTTTG TGG (reversed) Intergenic
No off target data available for this crispr