ID: 1173737850

View in Genome Browser
Species Human (GRCh38)
Location 20:45374362-45374384
Sequence TCGGAGGATCGCTTAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131363
Summary {0: 2, 1: 221, 2: 5459, 3: 35010, 4: 90671}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173737850_1173737857 27 Left 1173737850 20:45374362-45374384 CCTGGGCTTAAGCGATCCTCCGA 0: 2
1: 221
2: 5459
3: 35010
4: 90671
Right 1173737857 20:45374412-45374434 CAAGCGCAAGGCACCACATCTGG 0: 1
1: 0
2: 17
3: 363
4: 4348
1173737850_1173737856 15 Left 1173737850 20:45374362-45374384 CCTGGGCTTAAGCGATCCTCCGA 0: 2
1: 221
2: 5459
3: 35010
4: 90671
Right 1173737856 20:45374400-45374422 TAGCTGATACTACAAGCGCAAGG 0: 1
1: 0
2: 6
3: 91
4: 699

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173737850 Original CRISPR TCGGAGGATCGCTTAAGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr