ID: 1173738049

View in Genome Browser
Species Human (GRCh38)
Location 20:45375551-45375573
Sequence TGCCTTTCCTCTCCCTGCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 1, 1: 1, 2: 7, 3: 64, 4: 511}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173738049_1173738051 -9 Left 1173738049 20:45375551-45375573 CCCTGGCAGGGAGAGGAAAGGCA 0: 1
1: 1
2: 7
3: 64
4: 511
Right 1173738051 20:45375565-45375587 GGAAAGGCAGTCAGCACAGCAGG 0: 1
1: 0
2: 3
3: 27
4: 285
1173738049_1173738052 -2 Left 1173738049 20:45375551-45375573 CCCTGGCAGGGAGAGGAAAGGCA 0: 1
1: 1
2: 7
3: 64
4: 511
Right 1173738052 20:45375572-45375594 CAGTCAGCACAGCAGGACCGAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1173738049_1173738053 4 Left 1173738049 20:45375551-45375573 CCCTGGCAGGGAGAGGAAAGGCA 0: 1
1: 1
2: 7
3: 64
4: 511
Right 1173738053 20:45375578-45375600 GCACAGCAGGACCGAGGCCCTGG 0: 1
1: 0
2: 2
3: 50
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173738049 Original CRISPR TGCCTTTCCTCTCCCTGCCA GGG (reversed) Exonic