ID: 1173738050

View in Genome Browser
Species Human (GRCh38)
Location 20:45375552-45375574
Sequence CTGCCTTTCCTCTCCCTGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 729
Summary {0: 1, 1: 0, 2: 5, 3: 73, 4: 650}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173738050_1173738053 3 Left 1173738050 20:45375552-45375574 CCTGGCAGGGAGAGGAAAGGCAG 0: 1
1: 0
2: 5
3: 73
4: 650
Right 1173738053 20:45375578-45375600 GCACAGCAGGACCGAGGCCCTGG 0: 1
1: 0
2: 2
3: 50
4: 303
1173738050_1173738051 -10 Left 1173738050 20:45375552-45375574 CCTGGCAGGGAGAGGAAAGGCAG 0: 1
1: 0
2: 5
3: 73
4: 650
Right 1173738051 20:45375565-45375587 GGAAAGGCAGTCAGCACAGCAGG 0: 1
1: 0
2: 3
3: 27
4: 285
1173738050_1173738052 -3 Left 1173738050 20:45375552-45375574 CCTGGCAGGGAGAGGAAAGGCAG 0: 1
1: 0
2: 5
3: 73
4: 650
Right 1173738052 20:45375572-45375594 CAGTCAGCACAGCAGGACCGAGG 0: 1
1: 0
2: 0
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173738050 Original CRISPR CTGCCTTTCCTCTCCCTGCC AGG (reversed) Exonic