ID: 1173738052

View in Genome Browser
Species Human (GRCh38)
Location 20:45375572-45375594
Sequence CAGTCAGCACAGCAGGACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173738050_1173738052 -3 Left 1173738050 20:45375552-45375574 CCTGGCAGGGAGAGGAAAGGCAG 0: 1
1: 0
2: 5
3: 73
4: 650
Right 1173738052 20:45375572-45375594 CAGTCAGCACAGCAGGACCGAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1173738049_1173738052 -2 Left 1173738049 20:45375551-45375573 CCCTGGCAGGGAGAGGAAAGGCA 0: 1
1: 1
2: 7
3: 64
4: 511
Right 1173738052 20:45375572-45375594 CAGTCAGCACAGCAGGACCGAGG 0: 1
1: 0
2: 0
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173738052 Original CRISPR CAGTCAGCACAGCAGGACCG AGG Intronic