ID: 1173738052

View in Genome Browser
Species Human (GRCh38)
Location 20:45375572-45375594
Sequence CAGTCAGCACAGCAGGACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173738049_1173738052 -2 Left 1173738049 20:45375551-45375573 CCCTGGCAGGGAGAGGAAAGGCA 0: 1
1: 1
2: 7
3: 64
4: 511
Right 1173738052 20:45375572-45375594 CAGTCAGCACAGCAGGACCGAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1173738050_1173738052 -3 Left 1173738050 20:45375552-45375574 CCTGGCAGGGAGAGGAAAGGCAG 0: 1
1: 0
2: 5
3: 73
4: 650
Right 1173738052 20:45375572-45375594 CAGTCAGCACAGCAGGACCGAGG 0: 1
1: 0
2: 0
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173738052 Original CRISPR CAGTCAGCACAGCAGGACCG AGG Intronic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
900767763 1:4516730-4516752 CAGACAGCACAGGAGGCTCGCGG - Intergenic
901217602 1:7563390-7563412 CCTGCAGCACAGCAGGACCTGGG + Intronic
902130415 1:14255447-14255469 TAGTCAGCCCAGCAAGACGGAGG + Intergenic
905455169 1:38083654-38083676 CAGCCTGCACAGCAGGGCGGGGG - Intergenic
906584649 1:46965669-46965691 CAGTCAGAAGAGCAGGATCAGGG + Intergenic
907391021 1:54158321-54158343 GAGTCAGCACAGCAGGGCACTGG - Intronic
907491229 1:54810167-54810189 CAGTGAGCACCACAGGACCTGGG - Intronic
907711508 1:56886889-56886911 CAGTCAGCATAGCATCACCTGGG + Intronic
911133847 1:94418531-94418553 CAGGCAGAGCAGCAGGAACGCGG - Exonic
912718741 1:112002200-112002222 CAGGCAGCACAGCCTGACCTGGG - Intergenic
914198150 1:145460954-145460976 CAGGCAGAACTGCAGGACCTGGG + Intergenic
915554817 1:156655548-156655570 CAGTCAGCACTGCAGGACAATGG + Intronic
916023582 1:160815020-160815042 CACTCAGTGCAGAAGGACCGGGG - Intronic
918936107 1:190924483-190924505 CAACCAGCACTGCAGGACCTAGG + Intergenic
920367163 1:205454251-205454273 CAGTCACGTCAGCAGGACTGTGG + Intronic
923325421 1:232876186-232876208 CAGTCAGCACAGCCCCACCGTGG + Intergenic
1063426758 10:5956417-5956439 CAGCCCACACAGCAGGACAGTGG + Exonic
1063973246 10:11396140-11396162 CAGTCAGCTCAGGAGAACGGTGG + Intergenic
1067052149 10:43027837-43027859 CTGCCAGCACAGCAGGAAAGTGG + Intergenic
1069694083 10:70374110-70374132 CAGTTACCACAGCAGCACTGGGG - Intronic
1073065310 10:100755236-100755258 CAGTCAGACCAACAGGACTGTGG - Intronic
1074857459 10:117483850-117483872 CAGTCAGGGCAGCAGGAGCGTGG - Intergenic
1075096291 10:119473781-119473803 CAGGCAGCACAGCAGGGCTGCGG - Intergenic
1075289922 10:121220224-121220246 CAGTCAGCCCTGCAGAACCAAGG + Intergenic
1076203033 10:128573120-128573142 CAGGCAGGGCAGCAGCACCGGGG + Intergenic
1080120064 11:28666866-28666888 CAGTGAGCACAGCAGGAGGGAGG + Intergenic
1081774998 11:45670758-45670780 CGGACTGCACAACAGGACCGTGG + Intergenic
1084220458 11:67674534-67674556 CAGTCAGCAGAGCAGGGCTGAGG - Exonic
1084403109 11:68956206-68956228 GAGGCAGCAAAGCAGGACCTCGG - Intergenic
1088693327 11:112345997-112346019 CAGTCTCCACAGCAGGCCAGAGG + Intergenic
1091699715 12:2651591-2651613 CAGTTAGCACAGCAAGAGGGGGG - Intronic
1094627578 12:32139179-32139201 CAGTCACCACAGCAGCCACGTGG - Intronic
1096512921 12:52141726-52141748 CAGGCAGCAGAGCGGGACCCTGG + Intergenic
1096575786 12:52552108-52552130 CAGTGAGCACAAGAGCACCGTGG + Intronic
1098803528 12:74992221-74992243 CAGACCACACAGCAGGACCAGGG + Intergenic
1101252944 12:102953066-102953088 CAGACACCCCAGCAGGACAGAGG + Intronic
1102087345 12:110153574-110153596 CAGTGAGGACATCAGGACCAGGG + Intronic
1105779422 13:23694011-23694033 CAGGCAGCACCGCAGGTCAGTGG + Intergenic
1105783629 13:23725926-23725948 GAGCCTGCACAGCAGGAGCGGGG + Intergenic
1106304033 13:28494802-28494824 CAGCGCGCACAGCAGGACCCCGG + Exonic
1106886836 13:34195700-34195722 TAGTCATCACAGCAGGATAGGGG + Intergenic
1107715479 13:43195376-43195398 CAGTCAGAAGAGCTGGACGGTGG - Intergenic
1112247919 13:97751113-97751135 TAGTTAGCACAGCTGGACAGTGG - Intergenic
1113506627 13:110821258-110821280 CAGTCAGCCCTGCTGGCCCGGGG + Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115645194 14:35364394-35364416 CTGTCAGGACAGCCTGACCGAGG + Intergenic
1119971202 14:78972634-78972656 AAGTCAGCAGAGCAGGGCAGGGG - Intronic
1120787766 14:88552215-88552237 CAGTCAGGAGAGCAGGACCCAGG - Intronic
1121520190 14:94581008-94581030 CAGTCAGCATAGCAGGCCTGTGG + Intronic
1121521069 14:94586650-94586672 CAGCCAGAACAGGAGGACGGTGG + Intronic
1122501569 14:102203609-102203631 CAGCCAACACAGCAGGCCAGGGG - Intronic
1123481714 15:20638592-20638614 CAGGCAGCACAGCAGGTGAGCGG - Intergenic
1123636299 15:22361773-22361795 CAGGCAGCACAGCAGGTGAGCGG + Intergenic
1126335487 15:47582622-47582644 CAGGCAGGACTGCAGGACTGAGG - Intronic
1126676443 15:51162713-51162735 AAGTCAACAAAGCAGGACTGTGG + Intergenic
1127414992 15:58749363-58749385 CAGTCAGCCCAGCCGGCCAGCGG - Intronic
1129112948 15:73348720-73348742 CAGTCAGCACTGCAGGGACATGG - Intronic
1131058924 15:89392493-89392515 CATCCAGCTCAGCAGAACCGGGG + Intergenic
1131548403 15:93334837-93334859 CAGTCACCACAGCAGAAACCTGG + Intergenic
1131920958 15:97328164-97328186 CAGTGAGCTCAGTAGGACCATGG + Intergenic
1132344406 15:101099623-101099645 CAGTCAGCACAGAAGAAGAGGGG - Intergenic
1132517617 16:373182-373204 CACTCAGCCCTGCAGGACCCTGG + Intronic
1134125578 16:11613697-11613719 CAGGGAGCACAGCCGGACGGAGG + Intronic
1134689236 16:16180191-16180213 CAGGCAGCACAGCAGGAGGTGGG - Intronic
1137620102 16:49870497-49870519 CTGTCAGGACAGCTGGACCCTGG - Intergenic
1137629158 16:49930083-49930105 CCTTCAGCACAGCTGGACCAAGG - Intergenic
1140093048 16:71852762-71852784 CGGTCAGCGCAGCAGGAGGGTGG - Exonic
1140728524 16:77835443-77835465 GACTCAGCACAGCTGGACCATGG - Intronic
1141461346 16:84180252-84180274 CAGTCGGGCCAGCAGGAGCGGGG + Exonic
1141681176 16:85544861-85544883 CAGGCAGCAGAACAGGACCGCGG + Intergenic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1144488069 17:15684111-15684133 CAGTCAGATCAGCGGGCCCGGGG + Intronic
1144912945 17:18698177-18698199 CAGTCAGATCAGCGGGCCCGGGG - Exonic
1145279476 17:21457242-21457264 AAATCAGCACAGCAGGAGGGAGG + Intergenic
1145398397 17:22513244-22513266 AAATCAGCACAGCAGGAAGGAGG - Intergenic
1146610769 17:34303160-34303182 CAGTCAGCACAGAAGAGCTGGGG - Intergenic
1146680631 17:34805217-34805239 CAGTCCACACAGCAGGAAGGAGG - Intergenic
1147548117 17:41418949-41418971 CAGTCAGGACACCTGGACCCTGG - Intergenic
1147791300 17:43015771-43015793 AAAGCAGCACAGCAGGCCCGGGG + Exonic
1151658610 17:75507301-75507323 CAGTGGGCACAGCAGGACTCTGG - Intronic
1151820234 17:76493082-76493104 CAGTCAGGACAGAAGGAGGGCGG + Intronic
1151875234 17:76864252-76864274 CAGCCAGGCCAGCAGGACCCAGG + Intergenic
1152430419 17:80245773-80245795 CAGTCAGGACAACAGGATGGAGG + Intronic
1153618736 18:6956580-6956602 CAGTCAGCAAAGGAGGGCCTAGG - Intronic
1153770161 18:8408826-8408848 GTGTCAGCACAGCAAGACTGAGG + Intergenic
1159619666 18:70622727-70622749 CAGTCAGCACAGGAAGACCAGGG - Intergenic
1160591603 18:79947877-79947899 CCCTCTGCACAGCAGGACCTGGG + Intronic
1160859705 19:1232503-1232525 CAGCCAGCTCAGCAGGGCCAGGG - Intronic
1161326822 19:3668073-3668095 CGGTCAGCGCAGCAGGGCCTGGG + Intronic
1161415861 19:4145932-4145954 CATTCTGCACAGGAGGACAGAGG - Intergenic
1166156974 19:40921044-40921066 GACACAGCACAGCAGGACCCTGG + Intergenic
1166166035 19:40989518-40989540 GACACAGCACAGCAAGACCGAGG + Intergenic
1166443663 19:42839250-42839272 CAGTCAGCCCTGCAGGAACCAGG + Intronic
1166463362 19:43009913-43009935 CAGTCAGCCCTGCAGGAACCAGG + Intronic
1166469504 19:43066472-43066494 CAGTCAGCTCTGCAGGAACCAGG + Intronic
1166480634 19:43170010-43170032 CAGTCAGCCCTGCAGGAACCAGG + Intronic
1166747355 19:45147656-45147678 CAGCCAGCACTGCAGGAGCCTGG + Intronic
1167638603 19:50668425-50668447 CAGCCAGGGCAGCAGCACCGAGG - Exonic
1167752213 19:51387953-51387975 CAGTCTGCACAGAGGGGCCGTGG - Exonic
1168697866 19:58415608-58415630 CAGTCAGCAGAGCAGAAGCCAGG + Exonic
925113088 2:1352956-1352978 CAGTCACCACAGCAGTTCAGGGG + Intronic
925912202 2:8581328-8581350 CAGGCAGCACACCAGGAGTGCGG + Intergenic
926123343 2:10256519-10256541 CAGCCAGCACAGCAGGTGCCAGG + Intergenic
928087113 2:28352831-28352853 CAGTCGTCACAGCAGGATGGTGG + Intergenic
929493761 2:42421442-42421464 CAAACAGCAGAGCAGGATCGTGG + Intronic
931427585 2:62185250-62185272 GAGTCAGCACAGCACTACCTTGG - Intergenic
931584449 2:63810289-63810311 AGGTCAACACAGCAGGACAGAGG - Intronic
931657618 2:64524465-64524487 CTGTCAGCGCAGCAGCACCATGG - Exonic
931894854 2:66717360-66717382 CAATCACCACAGCAGAACCTTGG + Intergenic
932803712 2:74765512-74765534 CAGTTAGCTCAGCAGGGCTGGGG - Intergenic
938054962 2:128208082-128208104 CAGGCCGCACAGCAGGAGCGGGG - Intergenic
938207609 2:129437546-129437568 CAGGCAGCTCAGCAGGACACAGG + Intergenic
941231663 2:162917708-162917730 CAGGCAGCACAGCAGAAAAGGGG - Intergenic
942524449 2:176838600-176838622 CAGTCAGCTCACCAGGGCCCTGG - Intergenic
945745768 2:213718590-213718612 CAGTCAGCCCTGCTGGCCCGGGG + Intronic
947057194 2:226118648-226118670 GTGTCAGAACAGCAGGACTGGGG - Intergenic
948121771 2:235536101-235536123 CAGTACACACAGCAGGACCCCGG + Intronic
948779277 2:240308072-240308094 CAGTCATCACAGGATGACCTTGG + Intergenic
949059777 2:241949970-241949992 CAGGGAGGACAGGAGGACCGAGG - Intergenic
1169195525 20:3680400-3680422 CCATCAGCCCAGCAGGACTGAGG - Intronic
1169437952 20:5610596-5610618 CAGGCAGCCCAGCAGAAGCGCGG + Intronic
1171367748 20:24637760-24637782 CAGTCACCACAGCAGGGCAGAGG + Intronic
1171448203 20:25219314-25219336 CAGACAGCACAGGAGGGCTGTGG + Intronic
1172512068 20:35507796-35507818 CAACCAGCACAGCAGAACTGGGG + Exonic
1172940980 20:38654499-38654521 AAGTTAGCACAGCAGGGCCTGGG - Intergenic
1173738052 20:45375572-45375594 CAGTCAGCACAGCAGGACCGAGG + Intronic
1175973203 20:62697517-62697539 CTGTGAGCACAGCAGGTCTGTGG + Intergenic
1182235365 22:28871008-28871030 CTGTCAGCAGAGCAGCACCAAGG - Intergenic
953436915 3:42884709-42884731 CAGGCAGCACAGCAGGAAATGGG - Intronic
955067194 3:55543741-55543763 GAGACAGCGCAGCAGGAACGAGG - Intronic
956588475 3:70888671-70888693 CAGTCAGCACTGTAGGAAAGTGG - Intergenic
960944530 3:122957067-122957089 GAGTCTGGAAAGCAGGACCGAGG + Intronic
961522115 3:127472918-127472940 CAGTCCTCACAGCAGAACTGGGG + Intergenic
964545673 3:157830730-157830752 CAATTAGCACAGCAGAATCGAGG + Intergenic
965602752 3:170471148-170471170 CAGACAGGACAACAGGACAGTGG + Intronic
968003993 3:195226826-195226848 CCGTCAGCACAGCAACATCGTGG + Exonic
968621384 4:1604863-1604885 CAGACAGCACTGCGGGAGCGGGG - Intergenic
969304836 4:6319649-6319671 CCTCCAGCACAGCAGGACTGCGG + Intergenic
969875024 4:10129832-10129854 CAGTCACCATAGCAGAACAGAGG - Intergenic
975023347 4:69518342-69518364 CAGCCAGCACAGCAGAGCTGAGG + Intronic
975166463 4:71183356-71183378 CTGTCAGCACAGCATGAGCTGGG - Intergenic
975494905 4:75027003-75027025 CAGACAGCAAAGGAGGATCGAGG - Intronic
982023398 4:151227987-151228009 CAGTCTGCACAGCTGGAATGTGG + Intronic
984714733 4:182915900-182915922 GAGTCAGCACAGGAGGAGGGTGG + Intronic
984823390 4:183904230-183904252 CAGGCAGCACAGCAGGAGGTGGG - Intronic
984991231 4:185383556-185383578 CAGTTACCACGGCAGGCCCGAGG + Intronic
985178134 4:187225241-187225263 CAGTGAGCTCAGCAGGTCCTCGG - Intergenic
986331987 5:6724023-6724045 CAGTCAGCACTGCTGCACTGGGG + Intronic
992944209 5:81793893-81793915 CAGGCAGCACAGCCTGACCCAGG - Intergenic
997527619 5:134563546-134563568 CAGTCCACACAGCAGGGCTGGGG - Intronic
998157324 5:139794593-139794615 CACTGAGCACAGCAGGATCAAGG + Intergenic
1002319377 5:178365897-178365919 CAGTGAACACAGCAGGAAGGGGG + Intronic
1004297739 6:14429351-14429373 CAGTCATCACAGCAGGAGACTGG + Intergenic
1005518433 6:26576724-26576746 CAGACAAAACAGCAGGACAGAGG + Intergenic
1005524150 6:26629094-26629116 CAGTCAGCCCTGCAGAACCACGG - Intergenic
1006335407 6:33417959-33417981 CACTCCGCCGAGCAGGACCGCGG + Intronic
1007180142 6:39923691-39923713 CAGCCAGCACAGGATGACAGAGG + Intronic
1011224177 6:85088743-85088765 TTGTCAGCACAGCATGACTGGGG + Intergenic
1013412897 6:109897607-109897629 CAGGCAGCACAGCAGAAAAGGGG + Intergenic
1016464922 6:144315692-144315714 CAGCCAGCACAGCGGCACGGAGG - Intronic
1019351313 7:555280-555302 CAGTCGGCACAGCAGCCCCGTGG - Intronic
1020794989 7:12668147-12668169 CAGTAAGTACAGCAGGATCTGGG + Intergenic
1021987498 7:26111101-26111123 CAGTCAGCAAAGCAGCAGAGTGG + Intergenic
1024325826 7:48108374-48108396 AAGTCATCACAGCAGGTCTGCGG - Exonic
1024634247 7:51274309-51274331 CAGTCAGCACTGGAGGACAAAGG - Intronic
1025247633 7:57329029-57329051 CTCACAGCACAGCAGGAGCGAGG + Intergenic
1026171169 7:67955174-67955196 CAGGCAGCAGAGAAGGACCTGGG + Intergenic
1026531830 7:71206248-71206270 CAGTCTGCTCAGCAGCACCTGGG + Intronic
1026877389 7:73887369-73887391 CAGGCAGGGCAGCAGGACTGGGG - Intergenic
1032710066 7:134453367-134453389 CAGTGACCCCAGCAGAACCGGGG - Intronic
1035324594 7:158056741-158056763 CAATCAACACAGCAGGACAGTGG + Intronic
1040445765 8:47491973-47491995 CAGGCAGTACAGGAGGAACGAGG + Intronic
1041858365 8:62483287-62483309 CACTCTGCAAAGCAGGACTGTGG - Intronic
1042801727 8:72725712-72725734 CAGTCTGGGCAGAAGGACCGGGG - Intronic
1045016736 8:98007113-98007135 CACTGTGCACAGCAGGACCATGG + Exonic
1048543796 8:135367352-135367374 CAGTCAATACAGCAGGAAAGAGG - Intergenic
1049388026 8:142354048-142354070 CTGACAGCAGAGCAGGAGCGGGG + Intronic
1051137270 9:13936420-13936442 CAGAAAGCACAGCATGACCCAGG + Intergenic
1051901740 9:22050371-22050393 CAGTCATCACAGCAGTACAGAGG - Intergenic
1053456927 9:38240314-38240336 CAGACAGCACAGCACGAGCAAGG + Intergenic
1054708894 9:68491105-68491127 CAGTCAGCTCATTAGCACCGAGG + Intronic
1059471534 9:114508373-114508395 AAGTCACCACAGCAGGCCAGTGG + Intergenic
1061930700 9:133831670-133831692 CAGTCAGCACAGGAGGGCTCCGG - Intronic
1062465355 9:136678400-136678422 CTGGCAGCACAGCAGGGCAGAGG - Intronic
1186276739 X:7947274-7947296 CAGGCAGCACAGCAGAAAAGGGG - Intergenic
1189704046 X:43742382-43742404 CAGTCAACACAGAAGGACATTGG + Intronic
1200063990 X:153496148-153496170 CAGCCAGGACAGCAGGAGAGAGG - Intronic
1200072153 X:153534523-153534545 CAGGGAGAACAGCAGGCCCGAGG - Intronic