ID: 1173741024

View in Genome Browser
Species Human (GRCh38)
Location 20:45402048-45402070
Sequence CAGCATCTGCATCTTGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173741024 Original CRISPR CAGCATCTGCATCTTGCACC TGG Intronic
900140007 1:1135846-1135868 GAGCAACTCCATCTTGCACAGGG - Intergenic
900185706 1:1332230-1332252 CGGCATCTGCATCGCGCACGAGG + Exonic
900384234 1:2402158-2402180 CCGCATCTGCAGCCAGCACCGGG - Intronic
901050058 1:6421468-6421490 CAGCATCTGCATCTTGGGGAGGG + Intronic
901103682 1:6738632-6738654 CTGCATTTTCATTTTGCACCAGG + Intergenic
901504647 1:9676841-9676863 CAGCCTCTTCATCTTTCAACAGG - Intronic
904206518 1:28858978-28859000 CAACATCTACATCTTCAACCTGG + Exonic
904785696 1:32981046-32981068 ATGCATCAGCATCTTGCAACTGG - Intergenic
904876394 1:33657853-33657875 CAGCAGCTGCATCTTGGGCCTGG - Intronic
905114987 1:35630886-35630908 CATTATCAGCATCTTCCACCAGG - Intronic
905980671 1:42223274-42223296 CAGCATCTTCCTCTTGCAATGGG + Intronic
906200563 1:43957503-43957525 CAGCATCAGCAACGTGCAGCTGG + Exonic
906232080 1:44172416-44172438 CAGCATCTACTTCTGGCCCCGGG + Intergenic
908561878 1:65314316-65314338 CAGCATCCACATTTTGAACCAGG + Intronic
909678803 1:78268254-78268276 CAGCATCTGCTTCTTGAAAATGG + Intergenic
911182553 1:94874250-94874272 CAGCTTCTGAACCATGCACCAGG - Intronic
912486299 1:110031589-110031611 CAGCAACTCCATCTTGAACAGGG - Intronic
912519379 1:110234734-110234756 CTGCGTTTCCATCTTGCACCAGG + Intronic
913077267 1:115351575-115351597 CATCATCTTCATCTCTCACCTGG + Intergenic
913706234 1:121426262-121426284 CATTATCTGCATTTTGCCCCAGG - Intergenic
915324727 1:155075486-155075508 CAGGTTCTGCACCTTGCACAGGG - Intergenic
917511521 1:175673067-175673089 GTGCATCTGCATCCTTCACCTGG + Intronic
918181623 1:182089505-182089527 CTGAAACTGCATCTTGCACTCGG + Intergenic
918963131 1:191306173-191306195 CAGCTTCTGCAGCTGGCACCAGG + Intergenic
920440366 1:205976598-205976620 CCGGATCTCCATTTTGCACCGGG + Intergenic
921586877 1:216957655-216957677 CAGCATCTCCCTCCTGGACCAGG + Intronic
922928479 1:229370748-229370770 CTGCAGCTGTAACTTGCACCGGG - Intergenic
923152361 1:231244881-231244903 AGGCATCTGCATCTTTCACTTGG - Intronic
1062900579 10:1142252-1142274 CAGCATCTCCACATTGCAACTGG + Intergenic
1062946125 10:1463405-1463427 CTGCATCTGCATCATGGACCAGG - Intronic
1064019135 10:11795230-11795252 CAGCATTTTCATTTTGCACTGGG + Intergenic
1068150318 10:53122911-53122933 GAGCATTTGCATCTTCCAACAGG + Intergenic
1068647042 10:59479632-59479654 CAGCATTGCCATCTTGCCCCTGG + Intergenic
1069891750 10:71656510-71656532 CATCATCTGCCTCCTGCCCCTGG - Intronic
1070006055 10:72425359-72425381 CAGCAGCTGCAGCTTGCTCAAGG + Intronic
1070688947 10:78510633-78510655 CAGCGTCTGCCTCCTGCACAGGG + Intergenic
1071505666 10:86230051-86230073 CAGCCCCTGCATCCTGCTCCTGG + Intronic
1073154438 10:101335236-101335258 CATCATCTGCATTTTCTACCAGG - Intergenic
1074401809 10:113147703-113147725 CAGCATTTGTATATTACACCTGG + Intronic
1074917752 10:117973940-117973962 CAGCATCTTGATCTTGGACTTGG - Intergenic
1075207923 10:120462746-120462768 CAGAATCTGCATTTTGAACAGGG + Intronic
1077037102 11:500486-500508 CAGCTTCTGGATCTTGCAGGAGG + Exonic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077229489 11:1452251-1452273 CAGCATCTGCAGCCTGTGCCAGG + Intronic
1078444092 11:11391138-11391160 CAGCAACTGTGTCCTGCACCTGG - Intronic
1078463320 11:11531642-11531664 CAGGGACTGTATCTTGCACCAGG + Intronic
1079054673 11:17195385-17195407 CAGAATCTTCCTCTTTCACCAGG - Intronic
1079077719 11:17394292-17394314 CAGCATCTTCATCATGGACGAGG - Exonic
1079101033 11:17542590-17542612 CAGGATCTGCATCAGACACCAGG + Intronic
1080427973 11:32173522-32173544 TAGCCTCTGCATCTGGGACCAGG - Intergenic
1082113740 11:48305510-48305532 TAGCATCTGCTTCTTGCAGGTGG + Intergenic
1082126446 11:48436513-48436535 CACCTTCTGCCTCTTGCACGTGG - Intergenic
1083235619 11:61349013-61349035 CAGCATCAGCATCCTACTCCTGG - Exonic
1085308633 11:75502717-75502739 CAGCTTCTGCCTCCTTCACCAGG + Intronic
1086152028 11:83622254-83622276 GAGCATTTTCATTTTGCACCGGG + Intronic
1086177901 11:83914309-83914331 CAGCATCTGCTTCTAGCAGAGGG - Intronic
1086538001 11:87872390-87872412 CACCATCAACATCCTGCACCTGG + Intergenic
1087168882 11:95030780-95030802 CAGCACTTGGATCTTTCACCAGG - Intergenic
1089351828 11:117825655-117825677 AAGCATCTGCCTCCTGCAGCAGG - Intronic
1089665555 11:120016030-120016052 CAGCATCTCCACCTTGCCACAGG - Intergenic
1090376436 11:126292873-126292895 CAGCATCTGGTACTTGCACCAGG - Exonic
1092187073 12:6488331-6488353 CTTCATCTGCCTCTTGCACTGGG + Intergenic
1092455196 12:8636825-8636847 CAGCAGCTGCATCTTGTCCATGG - Intergenic
1092992002 12:13912054-13912076 CAGCAACTGCACCTTACACAGGG + Intronic
1093092213 12:14934855-14934877 CACCATCTGCCTCTTTCGCCTGG - Exonic
1095215991 12:39548521-39548543 CAGCATCTGCATGTTGAAAAAGG + Intergenic
1095959075 12:47822537-47822559 CAGCATGTGCAACCTGCATCTGG + Intronic
1095966873 12:47873821-47873843 CAGCCTCTGCTTCATGCTCCTGG - Intronic
1096273468 12:50185429-50185451 CAGCTTCTGCCTCCTGCTCCTGG - Intronic
1098167641 12:67714579-67714601 CAGCCTCTGCATATTATACCTGG + Intergenic
1098184214 12:67879013-67879035 GAGTATTTGCATCTTCCACCAGG - Intergenic
1103447758 12:121005360-121005382 CAGCTTCAGCACCTGGCACCTGG - Intronic
1103604437 12:122076754-122076776 CAGGATCTGGCTCTTTCACCTGG - Intergenic
1104080546 12:125426819-125426841 CAGCGTCTGACTCTTGCACTAGG - Intronic
1104430444 12:128711679-128711701 CATCTTTTGCATGTTGCACCAGG - Intergenic
1104553050 12:129774901-129774923 CATCATCTCCATTTTGCAGCTGG - Intronic
1105606899 13:21933403-21933425 AAGCAGCTGCAGCCTGCACCAGG - Intergenic
1106882582 13:34148184-34148206 CAGCAGCTGCATCTTCCTCATGG + Intergenic
1106987478 13:35372487-35372509 CAGCATATGCATGTATCACCAGG - Intronic
1107432859 13:40355484-40355506 AAGCACCTCCAACTTGCACCTGG + Intergenic
1107714472 13:43186529-43186551 GAGCATCTTCATCATGCTCCAGG + Intergenic
1108796142 13:54033220-54033242 CAGCTTTTGCAACGTGCACCTGG - Intergenic
1109050354 13:57472928-57472950 CACCATCTACATCTAACACCTGG + Intergenic
1109808137 13:67470934-67470956 CAGCATCTGCATGTACCACAGGG - Intergenic
1111566861 13:90028011-90028033 AACCATTTGCATCTTACACCTGG + Intergenic
1111750371 13:92322877-92322899 AAGCATCTGCATCTCACACCAGG + Intronic
1112242501 13:97695698-97695720 CAGCCTCTGCATCTTGCTGGTGG + Intergenic
1113108346 13:106795700-106795722 GAGCAACTCCATCTTGCACAGGG + Intergenic
1113444853 13:110357209-110357231 CACCATCGACATCCTGCACCAGG - Intronic
1113549422 13:111180871-111180893 CATAATCTGCATCATGCAACTGG + Intronic
1113664485 13:112131793-112131815 CAGCATGGGAATCTAGCACCTGG + Intergenic
1114337984 14:21712796-21712818 CAGCATCTGCCTCCCGCACCTGG - Intergenic
1122105068 14:99446806-99446828 CAGCATCTGCATCCTGCCCTCGG - Intronic
1123821869 15:24038299-24038321 CGGCATCTGCCTCTGGCTCCAGG - Intergenic
1123860222 15:24458511-24458533 CAGGATCTGGCTCTTACACCTGG + Intergenic
1125452548 15:39824208-39824230 CAGCATCTGCTTCTGGCCTCAGG - Intronic
1127454760 15:59146919-59146941 CAGCAACTTCTTTTTGCACCAGG + Intronic
1128542287 15:68544500-68544522 CATCCTCTGCATCCTCCACCTGG - Intergenic
1128668583 15:69557284-69557306 CAGCATTTCCATTTTGCACAGGG - Intergenic
1128812136 15:70580425-70580447 CAGGAGCTGCATCCTGCACAAGG - Intergenic
1128958432 15:71974066-71974088 GAGCATTTGCATCTTCCACTGGG - Intronic
1129192430 15:73945300-73945322 TACCATCTACATCTTGCACTGGG - Intronic
1129707773 15:77804564-77804586 CAGCTTCTCCATCTTACACCCGG + Intronic
1131829073 15:96342976-96342998 CAGCCTCTGGATCTTAGACCGGG + Intergenic
1135804674 16:25532015-25532037 CAGAATCTGCATCTTTAACAAGG + Intergenic
1135976461 16:27111607-27111629 CTGCATCTGTCTCCTGCACCAGG + Intergenic
1136656245 16:31711013-31711035 CAGCCTCTCCATCTTCCAACAGG + Intergenic
1138273992 16:55717730-55717752 GAGTATTTGCATCTTCCACCAGG - Intergenic
1142118509 16:88373920-88373942 CAGCCTCTGCCTCTTCCTCCTGG - Intergenic
1143112463 17:4560098-4560120 CAGCAGGTGCCTCCTGCACCAGG + Intronic
1145296100 17:21593591-21593613 CAGCCCCTGCAGCATGCACCCGG - Intergenic
1146828725 17:36047762-36047784 CAGCTTCTGCAAGTGGCACCTGG - Intergenic
1148705042 17:49622695-49622717 CAGCCTGTGAATCTTGCATCTGG - Intronic
1149213180 17:54326696-54326718 CAGCAACTCCATCTTGAACAGGG - Intergenic
1149329958 17:55570430-55570452 CAGCTTCTCCAGCTGGCACCAGG - Intergenic
1151378054 17:73705142-73705164 CAGCATCTCCTTCCTGCCCCAGG - Intergenic
1152099164 17:78291104-78291126 CTGCATCTTCATTTTGCACTGGG + Intergenic
1152889335 17:82871609-82871631 CAGCGTCTGAAGCTTCCACCTGG + Intronic
1154354208 18:13612469-13612491 CAGCATTTGAGTCTAGCACCTGG + Intronic
1160186592 18:76680908-76680930 CAGAATCTGCCTCCTGCACTGGG - Intergenic
1160328287 18:77969601-77969623 CAGCATCTGCATCTGCCCCTGGG - Intergenic
1160328340 18:77969799-77969821 CAGCATCTGCATCTGCCCCTGGG - Intergenic
1160328349 18:77969837-77969859 CAGCATCTGCATCTGCCCCTGGG - Intergenic
1161631485 19:5358866-5358888 CCTCAGCTGCATCTTGCACCTGG + Intergenic
1162097102 19:8316820-8316842 CACCATCTGCTTCTGGCCCCAGG - Intronic
1162824187 19:13241520-13241542 CAACATCTGCATCTAGAATCCGG - Intronic
1165434985 19:35790599-35790621 CAGCTTCTGCATCCTGATCCAGG - Intergenic
1166401883 19:42487669-42487691 GAGCAACTGCATCTTGAACAGGG - Intergenic
1167269889 19:48500826-48500848 CAGCATCTGCTACTTGCAGGGGG - Intronic
1167358157 19:49016516-49016538 CAGCATCTGCCCCTGGCCCCAGG + Intronic
1167655093 19:50758604-50758626 CACCGTCTGCTTCTTCCACCTGG + Intergenic
1167656895 19:50770831-50770853 CACCGTCTGCTTCTTCCACCTGG + Exonic
1167737562 19:51305571-51305593 GAGCATTTGCATCTTCCACTGGG + Intergenic
1168687848 19:58359047-58359069 CAGCATCTGCTCCTTGGAGCAGG + Intronic
1202646102 1_KI270706v1_random:143310-143332 CAGCATCTTCCTCTGTCACCAGG - Intergenic
925315567 2:2920250-2920272 CTGCATGTTCATCTGGCACCGGG + Intergenic
927813675 2:26195185-26195207 CAGCAGCTGCATCTTGTCCACGG + Exonic
936493227 2:112993918-112993940 CAGCATCTCCATCCTGCTACAGG + Intergenic
937098029 2:119248313-119248335 CAGAATCTGCAGTTGGCACCTGG - Intronic
938569057 2:132545565-132545587 CAGCATCTGGATCTGGAACAGGG - Intronic
940570624 2:155428391-155428413 CAGCATTTTCATTTTGCACTGGG + Intergenic
941030014 2:160500225-160500247 CAGCACCTTGATCTTGGACCTGG + Intergenic
941066253 2:160906261-160906283 CAGAATCTGCATTTTGAAACAGG - Intergenic
941193992 2:162423447-162423469 CAGCATCTGCATGTGGTACCTGG + Exonic
942642100 2:178071693-178071715 CAGCAGCTGCCCCTTCCACCAGG + Exonic
944349782 2:198713304-198713326 CAGCATTTGCATTTTGGGCCAGG - Intergenic
944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG + Intronic
945414636 2:209555873-209555895 CAGCATCTGCAGTTTGTAACAGG + Intronic
946883552 2:224200594-224200616 CAGCATTTTCATTTTGCACTGGG + Intergenic
947051900 2:226054676-226054698 CAGCATTTTCGTCTTGCACTGGG - Intergenic
947459952 2:230295425-230295447 CAGCATCTCTACCTTTCACCGGG + Intronic
948691950 2:239711700-239711722 CAGAATCTGTGTCCTGCACCTGG + Intergenic
1169385595 20:5146518-5146540 CAGCATCTTCATCTGTCATCTGG - Intronic
1171727847 20:28642089-28642111 TGTCATCTGCATCTTTCACCTGG + Intergenic
1173741024 20:45402048-45402070 CAGCATCTGCATCTTGCACCTGG + Intronic
1175681433 20:60991675-60991697 CAGTATTTGCATCTCTCACCTGG + Intergenic
1175786215 20:61713234-61713256 CAGGATGTGCACCTTGAACCTGG - Intronic
1175799390 20:61792431-61792453 CAGCAGCTGCATCTTGGAAGAGG - Intronic
1176605774 21:8829436-8829458 CAGCATCTTCCTCTGTCACCAGG + Intergenic
1176957415 21:15121944-15121966 CAGCATTTACATCTTGAAGCAGG + Intergenic
1177126632 21:17201839-17201861 CAGCATCTGCTTCTCACACAGGG + Intergenic
1179302680 21:40126487-40126509 TAGCATCTGCATTTTTCAACTGG - Intronic
1179674551 21:42973201-42973223 TTGCATCTGGATCTTGCACTAGG + Intergenic
1180348072 22:11721041-11721063 CAGCATCTTCCTCTGTCACCAGG + Intergenic
1180355847 22:11839138-11839160 CAGCATCTTCCTCTGTCACCAGG + Intergenic
1180382409 22:12153187-12153209 CAGCATCTTCCTCTGTCACCAGG - Intergenic
1182027088 22:27128701-27128723 CTGCATTTTCATTTTGCACCAGG + Intergenic
1183092432 22:35531944-35531966 CATCATCAGCAGCCTGCACCTGG + Intergenic
1183689184 22:39378695-39378717 CAGCATCTCCAGCGTGCAGCAGG - Intronic
1184101369 22:42343387-42343409 CAGCATCCGCGTCTGGCACGTGG - Intronic
1184928109 22:47658509-47658531 CAGAATCTGCATCTTTCTCCTGG + Intergenic
953820521 3:46204085-46204107 CAGCATCTACCTCCTGAACCTGG - Exonic
956481239 3:69675813-69675835 CAGCAGCAGCATCTGGCTCCAGG - Intergenic
956978835 3:74614016-74614038 CACATTCTGCATCATGCACCTGG + Intergenic
957754363 3:84467470-84467492 CAGCATCTGCATCTTTGAAGAGG + Intergenic
959805931 3:110553723-110553745 AAGCATCGTCATCTTTCACCTGG + Intergenic
960038526 3:113126125-113126147 CAGCGTCAGGAACTTGCACCTGG - Intergenic
961053798 3:123769222-123769244 CACCAACTCCTTCTTGCACCTGG - Intronic
961782050 3:129326146-129326168 AAGCATCTGCATTTTTCACAAGG - Intergenic
962713089 3:138103764-138103786 CACCTTCTGCAACTTGGACCGGG - Exonic
965548628 3:169940710-169940732 CAGCATCTGTAACTCACACCTGG - Intergenic
967399115 3:189041017-189041039 GAGCACCTGCATCTTGAACCAGG + Intronic
972418272 4:38863740-38863762 AAGCATCATCATCTTTCACCTGG + Intergenic
973372332 4:49261545-49261567 CAGCATCTTCCTCTGTCACCAGG - Intergenic
973388665 4:49533589-49533611 CAGCATCTTCCTCTGTCACCAGG + Intergenic
974274460 4:59699859-59699881 CAGGATCTGCATCTTGAAAGAGG - Intergenic
975649839 4:76581867-76581889 CATCATCATCATCTTGGACCTGG + Intronic
976985951 4:91298294-91298316 CAGCAACTGCATCTTGCCTGTGG - Intronic
982778801 4:159468681-159468703 CTGCATTTGCATTTTGCACGGGG - Intergenic
984278693 4:177640772-177640794 CAGGATCTGCAGCTTCCTCCAGG - Intergenic
987344279 5:16964936-16964958 AGGCATCTTCATTTTGCACCAGG + Intergenic
988544989 5:32147351-32147373 CAGCCTCCGCCTCCTGCACCAGG - Intronic
989212013 5:38865986-38866008 CAGCATCTGCACCTGCCTCCTGG - Intronic
990539267 5:56756338-56756360 CACCATCGGGATCCTGCACCCGG - Intergenic
990649106 5:57878184-57878206 CAGGATCTACATCTAGAACCAGG + Intergenic
992066294 5:73113207-73113229 CAGCATCTGCCTCTGGCTTCTGG + Intergenic
992090139 5:73309838-73309860 CTGCATTTGCATTTTGCACTGGG - Intergenic
992902399 5:81310988-81311010 CACCCACTGCTTCTTGCACCTGG - Intronic
993719821 5:91311295-91311317 CAGCCCCAGCATCTAGCACCTGG - Intergenic
997675854 5:135712735-135712757 CCGCATCTGCCCCTTGCACTTGG + Intergenic
999142174 5:149369748-149369770 CGGCATCTGCATCTTTCTCAAGG - Intergenic
999273030 5:150309081-150309103 CATTATCTGCATCTTGCCCATGG + Intronic
999829760 5:155307307-155307329 CACCATCTGCATTTGGCACAGGG + Intergenic
1001409835 5:171503123-171503145 CAGCATGTGCAGCCTCCACCTGG - Intergenic
1006555073 6:34859000-34859022 CTGCTTATGCATCCTGCACCCGG + Exonic
1007986802 6:46215433-46215455 CAGCATCTGCATCTGCATCCCGG - Intergenic
1010927678 6:81763596-81763618 CTGCATCTCCATCCTGCAACTGG + Intergenic
1011668129 6:89655812-89655834 ATGCATCTGCATCCTCCACCTGG + Exonic
1011930904 6:92711272-92711294 CAGCATCTGCAACTTGTACTGGG - Intergenic
1014609891 6:123529077-123529099 CACCATTTGCATTTTGGACCTGG - Exonic
1015663834 6:135604536-135604558 CAGCTTCCGCAGCTGGCACCAGG - Intergenic
1015768631 6:136746050-136746072 CATCATCAGCATTTCGCACCTGG - Intronic
1015793342 6:136986210-136986232 CAACATTTTCATTTTGCACCGGG + Intergenic
1016948985 6:149562160-149562182 CAGGGTCTGCATCTTGGCCCTGG + Intergenic
1017252999 6:152301989-152302011 CATCGTCAGCATCTTGCACTTGG + Exonic
1017988574 6:159466419-159466441 CAACATCTGGATCCTGAACCTGG + Intergenic
1018082141 6:160268213-160268235 GAGCATTTGCATCCTCCACCGGG - Intronic
1018394974 6:163371112-163371134 CAGCATCTGTTTGTTGCATCTGG - Intergenic
1019073588 6:169369249-169369271 CAGCATCGGCAGCCTGCACAGGG - Intergenic
1019151097 6:170006391-170006413 CTGCATTTTCATTTTGCACCAGG + Intergenic
1019528140 7:1490110-1490132 CAGCCTCTGCATGTGGCTCCAGG - Intronic
1019560469 7:1653589-1653611 CAGCATCTACATGGAGCACCTGG - Intergenic
1023699511 7:42878472-42878494 CAGCTTCTACAGCTGGCACCAGG - Intergenic
1023845214 7:44116579-44116601 CAACAACTGCATCTTCCAGCTGG - Intronic
1024711227 7:52017126-52017148 TCGCATCTGCCTCTTTCACCTGG - Intergenic
1024787278 7:52922663-52922685 CATCCTGTGCATCTTGCATCAGG - Intergenic
1025105698 7:56170454-56170476 CAGCATCTTCAACTTGAAACAGG + Intergenic
1026314791 7:69218967-69218989 CAGCATCTTCAACTTGAAACAGG + Intergenic
1028729824 7:94133477-94133499 CAGCATCTGAACCTTGGTCCAGG + Intergenic
1029823042 7:103162936-103162958 CAGCACCTGATTTTTGCACCTGG + Intergenic
1030610126 7:111680141-111680163 CACCATCTCCATCTTGAACAGGG - Intergenic
1031148554 7:118025842-118025864 CTGCATTTGCATTTTGCACTGGG - Intergenic
1032117150 7:129126943-129126965 CAGCATCTGCATGGAGCACATGG + Intergenic
1032297241 7:130650748-130650770 CACCATCTGCCTCTTTCATCAGG - Intronic
1034426547 7:151017035-151017057 CAGCAACTGCACCTCGCCCCTGG - Exonic
1035247492 7:157573356-157573378 CAGCCTCTGAATCTTGCAAATGG + Intronic
1038928251 8:32164512-32164534 CAGCCTCTTCATTTTGCTCCTGG - Intronic
1041419269 8:57648267-57648289 CAGGTTTTGCATCTTGCTCCAGG + Intergenic
1042385838 8:68173271-68173293 CAGCATCTGCACCTTTCAAATGG - Intronic
1042516429 8:69663683-69663705 CAGAATCTGCATCCACCACCGGG + Intergenic
1045429203 8:102097524-102097546 CAGCATCTACATGTCTCACCGGG - Intronic
1045939717 8:107725913-107725935 CACAATCTGCATCTTGCAACTGG - Intergenic
1048496737 8:134941910-134941932 CAGCATCTGCATCTGTGACAGGG + Intergenic
1048876825 8:138843191-138843213 CAGCATCTGCATCTTGTGCCTGG - Intronic
1049263169 8:141650697-141650719 CAGCAGCTGCCTCTGGCCCCCGG - Intergenic
1050794512 9:9521471-9521493 TATCATCTGCATCTTGAAACTGG + Intronic
1052048060 9:23818336-23818358 CTGCATTTTCATCTTGCACTGGG - Intronic
1053017049 9:34667833-34667855 CAGCATCTGCCCCTCACACCAGG - Intergenic
1053721887 9:40954998-40955020 TGTCATCTGCATCTTTCACCTGG - Intergenic
1054344078 9:63896991-63897013 TGTCATCTGCATCTTTCACCTGG + Intergenic
1056214981 9:84398159-84398181 CAGCATCTGCTTCCTGGCCCGGG - Intergenic
1057503201 9:95611996-95612018 CATCAGCTACATATTGCACCAGG - Intergenic
1059420369 9:114186827-114186849 CAGCATCAGCACCCTGCCCCAGG - Intronic
1059770274 9:117417215-117417237 CTGCATCTCCATATAGCACCTGG - Intergenic
1060927186 9:127463252-127463274 CACCACCTGCCTCCTGCACCTGG - Intronic
1203421138 Un_KI270448v1:7255-7277 TGTCATCTGCATCTTTCACCTGG - Intergenic
1203553170 Un_KI270743v1:181454-181476 CAGCATCTTCCTCTGTCACCAGG + Intergenic
1186397240 X:9222465-9222487 CAGCATCTGCAGCTCGCTCCAGG - Intergenic
1189730798 X:44018457-44018479 CTGCATTTTCATTTTGCACCGGG - Intergenic
1192001866 X:67159630-67159652 CAGCACCTGCATCTTGCTCAAGG - Intergenic
1193108314 X:77703474-77703496 CAGCATCCACAGCTGGCACCAGG + Intronic
1194617625 X:96126155-96126177 CAGCATCAGAATCTTGCAAGAGG + Intergenic
1197609451 X:128622579-128622601 CAGCTTCTACAGCTGGCACCAGG + Intergenic
1198887531 X:141355682-141355704 CATCATCTGCATCTGCCAGCTGG - Intergenic
1198972486 X:142297962-142297984 CAGCATCTGTATCTAGCTCAAGG - Intergenic
1199088393 X:143661257-143661279 CAGCCTTTGCATCTTGCTGCCGG + Intergenic
1200167565 X:154047797-154047819 CTGCATTTTCATTTTGCACCAGG - Intronic
1200944492 Y:8820065-8820087 ATCCATCTGCACCTTGCACCAGG - Intergenic
1201358946 Y:13125674-13125696 CATCATGAGCATCTTGAACCTGG + Intergenic