ID: 1173742669

View in Genome Browser
Species Human (GRCh38)
Location 20:45412425-45412447
Sequence AGCTTCCTAGAGACAGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173742669_1173742674 13 Left 1173742669 20:45412425-45412447 CCATTCCCTGTCTCTAGGAAGCT No data
Right 1173742674 20:45412461-45412483 CCTTCTGTGCAAAAGCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173742669 Original CRISPR AGCTTCCTAGAGACAGGGAA TGG (reversed) Intergenic