ID: 1173742707

View in Genome Browser
Species Human (GRCh38)
Location 20:45412694-45412716
Sequence TCCCAATAGCTTTGCTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173742699_1173742707 25 Left 1173742699 20:45412646-45412668 CCTCCTGTCTGACTGTGGCTGAG No data
Right 1173742707 20:45412694-45412716 TCCCAATAGCTTTGCTGTGCAGG No data
1173742700_1173742707 22 Left 1173742700 20:45412649-45412671 CCTGTCTGACTGTGGCTGAGCCA No data
Right 1173742707 20:45412694-45412716 TCCCAATAGCTTTGCTGTGCAGG No data
1173742704_1173742707 2 Left 1173742704 20:45412669-45412691 CCATCTCTTGGGCTGCGGCCCAT No data
Right 1173742707 20:45412694-45412716 TCCCAATAGCTTTGCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173742707 Original CRISPR TCCCAATAGCTTTGCTGTGC AGG Intergenic