ID: 1173743057

View in Genome Browser
Species Human (GRCh38)
Location 20:45416172-45416194
Sequence AACAGGACGAGCAGAGCAAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173743057_1173743064 -1 Left 1173743057 20:45416172-45416194 CCGCTTGCTCTGCTCGTCCTGTT 0: 1
1: 0
2: 2
3: 17
4: 240
Right 1173743064 20:45416194-45416216 TGCTCCTGGGGCCCGGCGGCTGG 0: 1
1: 0
2: 2
3: 31
4: 304
1173743057_1173743061 -8 Left 1173743057 20:45416172-45416194 CCGCTTGCTCTGCTCGTCCTGTT 0: 1
1: 0
2: 2
3: 17
4: 240
Right 1173743061 20:45416187-45416209 GTCCTGTTGCTCCTGGGGCCCGG 0: 1
1: 0
2: 7
3: 28
4: 326
1173743057_1173743063 -5 Left 1173743057 20:45416172-45416194 CCGCTTGCTCTGCTCGTCCTGTT 0: 1
1: 0
2: 2
3: 17
4: 240
Right 1173743063 20:45416190-45416212 CTGTTGCTCCTGGGGCCCGGCGG 0: 1
1: 0
2: 4
3: 24
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173743057 Original CRISPR AACAGGACGAGCAGAGCAAG CGG (reversed) Exonic
900885992 1:5415750-5415772 AACAGGAGGAGGAGAACAAAAGG - Intergenic
903860255 1:26360487-26360509 AGCAGGAGGAGCTGGGCAAGGGG + Intergenic
904151691 1:28446808-28446830 AACAGGAGCAAGAGAGCAAGGGG - Intronic
904573008 1:31481440-31481462 AAGAGGAGGAGAAGAGGAAGAGG + Intergenic
905472425 1:38203575-38203597 AACAGGTAGAGAAGAGAAAGTGG + Intergenic
907318346 1:53586997-53587019 AACAGGAGGCACAGAGAAAGGGG + Intronic
909556309 1:76958125-76958147 ATCATGACCAGCAGAGCAAACGG - Intronic
912285572 1:108365070-108365092 AGCAGGACCAGGAGAGGAAGAGG - Intergenic
913937499 1:125067531-125067553 AACAGGGGAGGCAGAGCAAGAGG - Intergenic
914960908 1:152206139-152206161 AACAGGAGGGGTAGAGGAAGAGG + Intergenic
915449496 1:155994766-155994788 AACAGGATGAGCAGATCTACAGG + Intronic
916220930 1:162444649-162444671 AAGAGGAGAAGCTGAGCAAGAGG - Intergenic
918249256 1:182686850-182686872 TACAGGAGGAGCAGAGAAAGAGG + Intergenic
919251554 1:195063094-195063116 AGGAGGAGGAGAAGAGCAAGAGG - Intergenic
919581187 1:199375380-199375402 TTCAGGACGAGCAAAGAAAGTGG + Intergenic
920202578 1:204268700-204268722 AACAGGACTCCCAGAGCAGGAGG - Intronic
921250766 1:213295818-213295840 AGGAGGAACAGCAGAGCAAGAGG + Intergenic
923759938 1:236832924-236832946 AAGAGGACCAACAGAGGAAGTGG - Intronic
924927972 1:248702010-248702032 AGCAGGAGGAGGAGAGCAAACGG + Intergenic
1063381526 10:5589019-5589041 AAAAGGAACAGCAGAGAAAGCGG + Intergenic
1064374451 10:14782975-14782997 GACAGGAGGGGCAGAGGAAGGGG + Intergenic
1064737035 10:18392491-18392513 AACAGGAAGAGAAGAGTTAGAGG + Intronic
1065198621 10:23291657-23291679 ACCAGGACGGGCAGCGCCAGGGG + Intronic
1065790294 10:29254326-29254348 AACAGGAGGAGGAGAACAGGAGG + Intergenic
1066146937 10:32569907-32569929 TAAAGAATGAGCAGAGCAAGAGG - Intronic
1067081672 10:43215945-43215967 GAAAGGACGAGCAGAGTGAGTGG + Intronic
1072027537 10:91476521-91476543 AACAGGGCAGACAGAGCAAGAGG + Intronic
1072318389 10:94225179-94225201 AACAGGAAAATCAGAGCAACAGG - Intronic
1073156428 10:101350795-101350817 TATAGGACGAGCACAGGAAGAGG - Intergenic
1073470285 10:103717873-103717895 ATCAGGCAGAGCAAAGCAAGGGG + Intronic
1075793510 10:125102842-125102864 TACAGGACTTGCAGAGCCAGTGG + Intronic
1076179033 10:128391646-128391668 AGCAGGAGGAAGAGAGCAAGGGG + Intergenic
1077130761 11:971319-971341 AGCAGGGAGAGCAGAGCAGGTGG + Intronic
1077738164 11:4813975-4813997 AACAGGCCGTGTACAGCAAGAGG + Intronic
1077822681 11:5765207-5765229 AAGAGGTAGAGCAGAGCCAGGGG - Intronic
1077975048 11:7239230-7239252 AACAGGAAGTGCAGAAGAAGGGG + Intronic
1078962932 11:16300650-16300672 AGCAGGAATGGCAGAGCAAGTGG + Intronic
1079007389 11:16801617-16801639 CTCAGGACGGGCTGAGCAAGGGG - Intronic
1083319932 11:61839250-61839272 AACAGTGTGCGCAGAGCAAGTGG + Intronic
1083887609 11:65580549-65580571 CACAGGGCGGGCACAGCAAGTGG - Intronic
1085405539 11:76259655-76259677 AGGAGGAAGAGCAGAGGAAGAGG + Intergenic
1086009818 11:82087547-82087569 AACAGGACGAGAAGGGCAAGGGG + Intergenic
1086402939 11:86475287-86475309 AACAGGAACAGGAGAGCAAAAGG - Intronic
1087177702 11:95110316-95110338 AAGAAGATGGGCAGAGCAAGGGG - Intronic
1088712899 11:112524444-112524466 ACCATGCCAAGCAGAGCAAGAGG - Intergenic
1089497725 11:118916197-118916219 AACATGATAAGCAGAGCCAGGGG + Intronic
1090375242 11:126283513-126283535 AACCCGAAGAGCAGAGGAAGAGG - Intronic
1090824083 11:130371422-130371444 GAAAGGAAGAGCAGAGAAAGGGG - Intergenic
1091139412 11:133222412-133222434 AACAGGACGAGCTGAGGAAGGGG + Intronic
1091548380 12:1519327-1519349 AACAAGACGGGGAGAGGAAGGGG - Intergenic
1096248849 12:50013686-50013708 GACAGCCTGAGCAGAGCAAGAGG - Intronic
1097250488 12:57629992-57630014 AACTGGACCAGCAGGGCCAGAGG - Intronic
1098221584 12:68275447-68275469 CACAGGATGAGAAGAGCAATGGG + Intronic
1100356733 12:93838168-93838190 ATCAGAACAAGCAGAACAAGGGG + Intronic
1100869574 12:98895455-98895477 AGGAGGACGAGGAGGGCAAGGGG + Intronic
1102013107 12:109631121-109631143 CACAGGACGGGCAGAACTAGGGG - Intergenic
1102165523 12:110803511-110803533 ATGAGGAAGAGAAGAGCAAGAGG - Intergenic
1102783719 12:115586884-115586906 AACAGGAGGAAGAGAGCAAGGGG - Intergenic
1110875030 13:80498659-80498681 AACAGGAGGAGAAGAGCAGTAGG + Intergenic
1112635243 13:101210084-101210106 AAAAGGAAAAGCAGAGCAGGTGG - Intronic
1113126597 13:106986216-106986238 AACAGGTCCACCAGAGCAAATGG - Intergenic
1114628476 14:24144898-24144920 AACAGAACGAGGAGAACAAAGGG + Intronic
1114969721 14:28011627-28011649 AACAGCAAGAGAAGAGAAAGAGG + Intergenic
1115304057 14:31915717-31915739 TACAGGATGAGCAGAAAAAGCGG - Intergenic
1118796452 14:69150215-69150237 AACAGGAAGAACTGAGCTAGAGG + Intronic
1119067345 14:71542273-71542295 AAGAGGAAGAGGAGAGGAAGAGG - Intronic
1119636753 14:76279512-76279534 AACAGGATGAGCACTGCAAGAGG - Intergenic
1122877416 14:104675096-104675118 AACAGGAGGAAGAGAGCAAAGGG + Intergenic
1124469131 15:29968189-29968211 TAGAGGACGAGCAAGGCAAGGGG - Intronic
1124870363 15:33535334-33535356 AAGAGGAAGAAAAGAGCAAGAGG - Intronic
1125478699 15:40065070-40065092 AACAGCATGAGCAGGGCACGTGG + Intergenic
1128257250 15:66206313-66206335 ATCAGAAGGAGAAGAGCAAGAGG + Intronic
1128421185 15:67492770-67492792 CACAGGAAGAGCAGTGCAGGTGG + Intronic
1128538948 15:68511647-68511669 TACAGAATGAGCAGAGGAAGAGG + Intergenic
1129062859 15:72874144-72874166 AACAGGAGGAGAAGAGCTTGTGG + Intergenic
1129206041 15:74037532-74037554 AACAAGGAGAGCAGAGGAAGGGG - Intronic
1129242226 15:74258474-74258496 AACAGGACAGGCAGGGCAGGTGG + Intronic
1129720500 15:77875434-77875456 GGCAGGATGGGCAGAGCAAGAGG - Intergenic
1131969938 15:97881755-97881777 AACAGGATGGGCAGAGGCAGAGG + Intergenic
1137870090 16:51941644-51941666 AACAGGAGCAACAGAGCAAGTGG + Intergenic
1137904175 16:52302213-52302235 AACAGGAGGAGGAAATCAAGGGG + Intergenic
1139688100 16:68620086-68620108 AACAGGAGGAGGAGAGGAATTGG - Intergenic
1142265427 16:89062163-89062185 AGCAGGATCAGCAGAGCAGGGGG + Intergenic
1143088743 17:4435971-4435993 GACAAGAAGAGAAGAGCAAGTGG - Intronic
1145083584 17:19916441-19916463 AATAGAACGAGCAGAGATAGTGG + Intronic
1145308213 17:21687134-21687156 AACAGGGGAGGCAGAGCAAGAGG + Intergenic
1145382368 17:22393650-22393672 AACAGGGGAAACAGAGCAAGAGG - Intergenic
1147699951 17:42387824-42387846 AACAGGGCAAGCGGAGGAAGTGG + Intronic
1147899746 17:43776329-43776351 AACAGGATGAGCAGAGGGATGGG + Intronic
1148219358 17:45850935-45850957 AAGAGGACTGGCAGAGTAAGAGG - Intergenic
1148271466 17:46265432-46265454 AAGAGGAGGAGGAGAGGAAGAGG - Intergenic
1149921921 17:60668270-60668292 AACATGAAGACCAGAGGAAGCGG + Intergenic
1151383939 17:73743841-73743863 AAAAGGACGAAGAGAGAAAGGGG - Intergenic
1156016878 18:32556350-32556372 ACTATCACGAGCAGAGCAAGGGG - Intergenic
1157181003 18:45497933-45497955 AACTGCAGGAGGAGAGCAAGGGG + Intronic
1158040402 18:53086150-53086172 AAGAGGAAGAGAAGAGGAAGAGG - Intronic
1158938172 18:62384274-62384296 AAAAGGAGGAGGAGAGGAAGAGG - Intronic
1159736601 18:72106643-72106665 AACAGAAGGAGCAGAGGATGAGG + Intergenic
1161066363 19:2240307-2240329 GACAGGCCCAGCAGAGCAAGGGG - Intronic
1163444922 19:17340657-17340679 AGGGGGAAGAGCAGAGCAAGAGG - Intronic
1164441591 19:28283860-28283882 AAGAGGACGATCAGAAAAAGAGG - Intergenic
1165123391 19:33577875-33577897 AGCAGCAGGAGCAGAGCAAATGG + Intergenic
1165245759 19:34497648-34497670 CCCAGCAAGAGCAGAGCAAGTGG + Intronic
1165509174 19:36256365-36256387 AACAGGGCAGACAGAGCAAGAGG - Intergenic
1165509686 19:36258780-36258802 AACAGGGCAGGCAGAGCAAGAGG - Intergenic
1165510712 19:36265325-36265347 AACAGGGCAGGCAGAGCAAGAGG - Intergenic
1165595896 19:37011101-37011123 AACAGGGCAGACAGAGCAAGAGG - Intronic
1165601397 19:37058062-37058084 AACAGGAGAGACAGAGCAAGAGG - Intronic
1165631528 19:37305666-37305688 AACAGGGCAGACAGAGCAAGAGG + Intergenic
1165758600 19:38308145-38308167 AACAGGGCGATGTGAGCAAGAGG + Intronic
1165789472 19:38482992-38483014 AAGAGGACGAGGTGAGCAAACGG - Intronic
1165862220 19:38915337-38915359 GACAGGAGAAGCAGAGGAAGAGG - Intronic
1167130546 19:47582337-47582359 AAGAGGAGGAGGAGAGGAAGAGG - Intergenic
1167701171 19:51046956-51046978 AACAGGAAGAGGAGGGCAGGTGG + Intergenic
925767918 2:7255004-7255026 ATCAGGTGGAGTAGAGCAAGAGG + Intergenic
926391112 2:12393828-12393850 AACAGGAAGAGGAGAGGAAGTGG + Intergenic
928394155 2:30931281-30931303 AAAAGGAAGAGGAGACCAAGTGG + Intronic
930430401 2:51268192-51268214 AACAGAGCCAGCAGAGCAGGAGG + Intergenic
930723389 2:54659182-54659204 AAGAGGAAGAGGAGAGGAAGAGG + Exonic
932590352 2:73062401-73062423 AAGAGGATGAGCAGGGGAAGAGG + Intronic
933966606 2:87434972-87434994 AACAGGGGGAGAAGAGAAAGAGG + Intergenic
936095568 2:109528303-109528325 ACAAGGCCCAGCAGAGCAAGGGG + Intergenic
936327187 2:111515515-111515537 AACAGGGGGAGAAGAGAAAGAGG - Intergenic
937436283 2:121884557-121884579 AACAGGATGCAGAGAGCAAGTGG + Intergenic
938029853 2:127982800-127982822 ATCAGGAAGAGCAGAGAAAGAGG + Intronic
940715325 2:157216437-157216459 AACAGAGGGAGAAGAGCAAGTGG - Intergenic
940923611 2:159338719-159338741 AACAGCATGAGCAGAGCACGAGG - Intronic
941355707 2:164488624-164488646 AATAGGACTAGAAAAGCAAGTGG - Intergenic
941562940 2:167071624-167071646 AACAGGAAGAGGTGAGGAAGTGG - Intronic
941595580 2:167472715-167472737 ATGAGGAAGAGCACAGCAAGCGG - Intergenic
942032691 2:171978616-171978638 AACAGCACAAGAAGACCAAGGGG - Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
943487276 2:188501776-188501798 AACAGCAGGAGCATACCAAGGGG - Intronic
945807295 2:214505236-214505258 AAAATGAGGAGCAGAGCCAGTGG - Intronic
946201648 2:218073996-218074018 TACAGGACAGACAGAGCAAGAGG + Intronic
946899112 2:224355329-224355351 AAGAGGAAGAGGAGAACAAGAGG - Intergenic
946899114 2:224355346-224355368 AAGAGGAGGAGGAGAACAAGAGG - Intergenic
948104375 2:235401213-235401235 AGCAGGATGAAGAGAGCAAGGGG - Intergenic
1170757700 20:19219170-19219192 AACAGGAAGAGAACAGCAGGGGG - Intronic
1171410369 20:24943087-24943109 AGCAGGACAGGCAGAGCAATGGG + Intergenic
1171523910 20:25795182-25795204 AACAGGGGAGGCAGAGCAAGAGG + Intronic
1171552917 20:26060701-26060723 AACAGGGGAGGCAGAGCAAGAGG - Intergenic
1171793258 20:29547618-29547640 GACAGGACGTGCAGAGGAAATGG - Intergenic
1171846889 20:30282856-30282878 AACAGGGGAGGCAGAGCAAGAGG - Intergenic
1171847427 20:30285474-30285496 AACAGGGGAGGCAGAGCAAGAGG + Intergenic
1172753617 20:37268333-37268355 AACAGGCCTAGAAGGGCAAGTGG - Intergenic
1173417789 20:42873011-42873033 CACAGGAAGAACAGAGCTAGAGG + Intronic
1173743057 20:45416172-45416194 AACAGGACGAGCAGAGCAAGCGG - Exonic
1173825677 20:46046256-46046278 AACAGCATGGGCAGAGAAAGGGG - Intronic
1174002892 20:47387692-47387714 AACAGGAACAGGAGAGAAAGGGG + Intergenic
1174191166 20:48741820-48741842 AACTGGTCCAGCAGAGGAAGCGG + Intronic
1175718253 20:61269695-61269717 AAGAGGAGGAGGAGAGCAGGAGG - Intronic
1176180149 20:63746123-63746145 AACAGGACGGGCAGAGCCCGGGG + Exonic
1180130266 21:45822571-45822593 GACAGGATTAGGAGAGCAAGGGG + Intronic
1181383746 22:22528317-22528339 AACAGGAACGACAGAGCAAGAGG + Intergenic
1181416480 22:22763002-22763024 AACAGGAAAAGCAGAGGAACAGG + Intronic
1183131306 22:35839394-35839416 AAAAGGATGAGGAGAGAAAGGGG + Intronic
1183192652 22:36331651-36331673 AACAGGAAGTACAGAGGAAGGGG + Intronic
1183782425 22:40007387-40007409 AAGAGGAGGAGGAGAGGAAGAGG - Intronic
1183782450 22:40007492-40007514 GACAGGAGGAGGAGAGGAAGAGG - Intronic
1184362363 22:44025988-44026010 AACAGGGCGATCAGAGCCAGGGG + Intronic
1184517379 22:44971031-44971053 AGCAGTACCAGCAGAGCATGAGG + Intronic
1184525057 22:45017549-45017571 AACAGGAACTGCAGAGCAGGAGG - Intergenic
1185031663 22:48446792-48446814 ACCAGGACGCACAGAACAAGGGG + Intergenic
950622311 3:14215640-14215662 AGCAGGAAGAGCAGAGAAGGGGG + Intergenic
951237094 3:20249463-20249485 CATAGTAAGAGCAGAGCAAGAGG + Intergenic
951449495 3:22820264-22820286 AACAGGAGGAAGGGAGCAAGAGG + Intergenic
954626821 3:52026378-52026400 TCCATGAGGAGCAGAGCAAGGGG - Intergenic
958641634 3:96813929-96813951 AACTTGACCAGCAGAGCGAGCGG - Intergenic
959348392 3:105228927-105228949 CACAGGGCGTGCATAGCAAGAGG - Intergenic
960051880 3:113247091-113247113 AAGAGGACAAGCAGACAAAGAGG - Intronic
961995809 3:131241187-131241209 AAGAGTAAGAGCAGAGAAAGAGG + Intronic
963978306 3:151507624-151507646 AACGAGACAAGCAGAGCAAAGGG + Intergenic
964003460 3:151805064-151805086 TGTAGGACTAGCAGAGCAAGGGG - Intergenic
964267801 3:154920388-154920410 AGCAGGAGGAAGAGAGCAAGGGG + Intergenic
965197332 3:165618253-165618275 AAGAGCAGGAACAGAGCAAGGGG + Intergenic
965981128 3:174692271-174692293 AACAAGAAGAGCAAAGCCAGAGG - Intronic
968883947 4:3317459-3317481 ACCAGGAGGAGAAGAGCAACCGG + Exonic
969598994 4:8164762-8164784 GAATGGAAGAGCAGAGCAAGGGG + Intergenic
972656419 4:41067825-41067847 AACAGAATAAACAGAGCAAGTGG + Intronic
973798081 4:54449172-54449194 AACAGGGCAAGGAGAGCCAGTGG + Intergenic
974083914 4:57239493-57239515 AATAGGAAAGGCAGAGCAAGTGG + Intergenic
977750603 4:100605463-100605485 AACAGGAGGTGCAAAGCAAGAGG + Intronic
980900466 4:138900481-138900503 AACAGGACTAGAAGGGAAAGGGG + Intergenic
980977013 4:139620898-139620920 AACAGGACATGCAAAGCAGGAGG - Intergenic
984725130 4:183013352-183013374 AAGAGGAAGAGAAGAGGAAGAGG - Intergenic
984875230 4:184362011-184362033 AACAGGAGCAAGAGAGCAAGGGG + Intergenic
985700917 5:1371889-1371911 AACAATACGAACAGGGCAAGAGG + Intergenic
985950932 5:3220831-3220853 AACGCCACAAGCAGAGCAAGGGG + Intergenic
988192177 5:27952264-27952286 AACAGGCCGAGAAGAGCCATTGG + Intergenic
988581416 5:32472124-32472146 AACAGGACTTGCTGAGCAATTGG - Intergenic
989344686 5:40416810-40416832 ACCAGGTAGAGCAGAGAAAGAGG + Intergenic
992733057 5:79691213-79691235 AACAGGAAGAGCAGAGGAGAAGG + Intronic
996347320 5:122501119-122501141 AAGAGGAAGAGAAGAGGAAGAGG - Intergenic
1000042037 5:157491927-157491949 AACAGAACGATCAGTGCAATGGG + Intronic
1000270360 5:159678186-159678208 AGCAGGAGGAAGAGAGCAAGTGG + Intergenic
1001129647 5:169053381-169053403 AACTGCATGAGCAAAGCAAGAGG - Intronic
1001146281 5:169187491-169187513 ATAAGGATGAGCAGACCAAGGGG - Intronic
1001272766 5:170327970-170327992 ATCAGGGTGAGCAGAGGAAGAGG - Intergenic
1003162997 6:3651904-3651926 AACAGGCCGTGCAGAGCACACGG + Intergenic
1005089012 6:22036716-22036738 AAATGGAAGAGCAGAGCAAATGG + Intergenic
1007123360 6:39401886-39401908 AACAAAACTAGCAGAGAAAGAGG + Intronic
1007479477 6:42140940-42140962 ACCAGGAGGAGCAGGGCAAGTGG - Intronic
1010166881 6:72925508-72925530 AACATGTCTAGAAGAGCAAGTGG - Intronic
1011500416 6:87982256-87982278 CTCAGGATGAGCAGAGCCAGAGG - Intergenic
1012648582 6:101721712-101721734 AACAGAAAGACCAGAGAAAGTGG - Intronic
1014270415 6:119330051-119330073 TACAGGATGTGCAGAGTAAGTGG - Intronic
1014365560 6:120536917-120536939 AACAGAAACAGCACAGCAAGGGG + Intergenic
1016320901 6:142844960-142844982 AACAGGACCAGGATAGAAAGGGG - Intronic
1017752025 6:157496911-157496933 GAGAGGAAGAGGAGAGCAAGAGG - Intronic
1018727180 6:166622152-166622174 AAAAGGACGGGCAAAGCAAAAGG + Intronic
1018969656 6:168517634-168517656 AACAGAAGGAGCAGAGCGCGTGG - Intronic
1019545866 7:1575858-1575880 AACAAGACGTGCAAAGCAAGTGG + Intergenic
1023735622 7:43233777-43233799 CACAGGAAGAGAGGAGCAAGTGG - Intronic
1028670055 7:93391779-93391801 AAGAGGCCGTGCAGAGGAAGGGG - Intergenic
1029192891 7:98784399-98784421 ATCTAGATGAGCAGAGCAAGGGG - Intergenic
1031924855 7:127629561-127629583 AACAGCACTAGAAGGGCAAGAGG + Intergenic
1033343917 7:140512679-140512701 CAGAGGACGAGGAGAGCAAGAGG + Intergenic
1034631773 7:152536530-152536552 AATAGGAACAGCACAGCAAGAGG - Intergenic
1034859281 7:154582120-154582142 ACCAGGACGAGGAGTGCAGGTGG - Intronic
1034994725 7:155570646-155570668 AGCAGGGCCAGCAGAGCCAGAGG + Intergenic
1035715987 8:1755359-1755381 AACAGGATGGGAAGAGCGAGGGG - Intergenic
1039144271 8:34428171-34428193 AACAGGACAACCAGATCAAAGGG - Intergenic
1044365073 8:91335895-91335917 AAGAGAGGGAGCAGAGCAAGAGG - Intronic
1046575204 8:116019526-116019548 AAAAGGTTGAGCAGAGAAAGGGG + Intergenic
1047352876 8:124092817-124092839 AGCAGGACGAAGAGAGAAAGCGG + Intronic
1047561066 8:125988588-125988610 AACAGGAAGATGAGAGGAAGAGG + Intergenic
1047753115 8:127897393-127897415 CATAGGAAGAGCAGAGTAAGGGG + Intergenic
1047983847 8:130212432-130212454 AACAGCACAACCAGAGCATGAGG + Intronic
1049299525 8:141862253-141862275 CACAGGACACACAGAGCAAGGGG - Intergenic
1049628459 8:143637298-143637320 AACAGGAAAAGCAGAACCAGAGG - Intronic
1050109400 9:2199542-2199564 AACAGGAGGAAGAGAGCAAAGGG + Intergenic
1050308920 9:4333301-4333323 AAAAGGAAGAGGAAAGCAAGGGG + Intronic
1053152272 9:35750587-35750609 AACAAGACTAGCACGGCAAGTGG - Intronic
1054730416 9:68697379-68697401 AACAGGATGGGGAAAGCAAGAGG - Intergenic
1055604809 9:77957544-77957566 AACAGCAGGAGAAAAGCAAGGGG + Intronic
1056113969 9:83423887-83423909 AACAGGGCTAGCAGAGCTCGGGG - Intronic
1057086328 9:92214211-92214233 AACAGAACAAGCAGAGCAGACGG + Intronic
1057092068 9:92267273-92267295 AACAGGAAGGGCAGAGAAAGAGG - Intronic
1057754124 9:97817735-97817757 AACAGTAAAAGCAAAGCAAGGGG + Intergenic
1059310372 9:113384756-113384778 AGCAGGAAGAGAAGAGCAAATGG - Intergenic
1059786657 9:117593603-117593625 AACAGGAGGAAGAGAGCAAAGGG - Intergenic
1061202879 9:129147543-129147565 AACGGGACGAACAGAGGGAGGGG - Exonic
1062159925 9:135074614-135074636 ACCAGGACGGGCAGAGCCAAGGG + Intergenic
1062428727 9:136517573-136517595 CACAGGGCCAGCAGAGCACGGGG - Intronic
1203769034 EBV:39972-39994 TACCGGGCCAGCAGAGCAAGCGG - Intergenic
1185575526 X:1169157-1169179 AAGAGGAGGAGAAGAGCAGGAGG + Intergenic
1187106450 X:16247896-16247918 AAGAAGATGAGAAGAGCAAGAGG + Intergenic
1189322743 X:40096487-40096509 AAGAAATCGAGCAGAGCAAGGGG - Intronic
1189378686 X:40485964-40485986 AACAGGAAGAGGAGAGTAAAGGG + Intergenic
1189835226 X:45013628-45013650 AACAGGATCAACAGAGCAGGGGG - Intronic
1193861268 X:86671541-86671563 AACAGGAGGAACAGAGTAAAGGG - Intronic
1194739097 X:97550866-97550888 AAGAAGACATGCAGAGCAAGAGG + Intronic
1195345839 X:103950372-103950394 AACAGAACAGGCAGAGCTAGTGG + Intronic
1195361759 X:104089065-104089087 AACAGAACAGGCAGAGCTAGTGG - Intergenic
1198480124 X:137033530-137033552 AAGAGAACAAGCAGAGGAAGAGG + Intergenic
1198873879 X:141202800-141202822 AGCAGGAGGAACAGAGCAAAGGG - Intergenic
1199893165 X:152108171-152108193 ATCATGACAACCAGAGCAAGGGG - Intergenic
1200255869 X:154582523-154582545 AACATCACGAGAATAGCAAGGGG - Intergenic
1200261900 X:154621880-154621902 AACATCACGAGAATAGCAAGGGG + Intergenic