ID: 1173745951

View in Genome Browser
Species Human (GRCh38)
Location 20:45437175-45437197
Sequence CCCAAGCCTACATTATCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173745951_1173745954 -1 Left 1173745951 20:45437175-45437197 CCACAAGATAATGTAGGCTTGGG No data
Right 1173745954 20:45437197-45437219 GCCTCAAGATAATGTCGGCATGG No data
1173745951_1173745956 13 Left 1173745951 20:45437175-45437197 CCACAAGATAATGTAGGCTTGGG No data
Right 1173745956 20:45437211-45437233 TCGGCATGGTGTCCCATCTTTGG No data
1173745951_1173745953 -6 Left 1173745951 20:45437175-45437197 CCACAAGATAATGTAGGCTTGGG No data
Right 1173745953 20:45437192-45437214 CTTGGGCCTCAAGATAATGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173745951 Original CRISPR CCCAAGCCTACATTATCTTG TGG (reversed) Intergenic
No off target data available for this crispr