ID: 1173745953

View in Genome Browser
Species Human (GRCh38)
Location 20:45437192-45437214
Sequence CTTGGGCCTCAAGATAATGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173745948_1173745953 22 Left 1173745948 20:45437147-45437169 CCATGAAACTGTGGTGGTCTTGT No data
Right 1173745953 20:45437192-45437214 CTTGGGCCTCAAGATAATGTCGG No data
1173745951_1173745953 -6 Left 1173745951 20:45437175-45437197 CCACAAGATAATGTAGGCTTGGG No data
Right 1173745953 20:45437192-45437214 CTTGGGCCTCAAGATAATGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173745953 Original CRISPR CTTGGGCCTCAAGATAATGT CGG Intergenic
No off target data available for this crispr