ID: 1173745954

View in Genome Browser
Species Human (GRCh38)
Location 20:45437197-45437219
Sequence GCCTCAAGATAATGTCGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173745951_1173745954 -1 Left 1173745951 20:45437175-45437197 CCACAAGATAATGTAGGCTTGGG No data
Right 1173745954 20:45437197-45437219 GCCTCAAGATAATGTCGGCATGG No data
1173745948_1173745954 27 Left 1173745948 20:45437147-45437169 CCATGAAACTGTGGTGGTCTTGT No data
Right 1173745954 20:45437197-45437219 GCCTCAAGATAATGTCGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173745954 Original CRISPR GCCTCAAGATAATGTCGGCA TGG Intergenic
No off target data available for this crispr