ID: 1173745956

View in Genome Browser
Species Human (GRCh38)
Location 20:45437211-45437233
Sequence TCGGCATGGTGTCCCATCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173745955_1173745956 -10 Left 1173745955 20:45437198-45437220 CCTCAAGATAATGTCGGCATGGT No data
Right 1173745956 20:45437211-45437233 TCGGCATGGTGTCCCATCTTTGG No data
1173745951_1173745956 13 Left 1173745951 20:45437175-45437197 CCACAAGATAATGTAGGCTTGGG No data
Right 1173745956 20:45437211-45437233 TCGGCATGGTGTCCCATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173745956 Original CRISPR TCGGCATGGTGTCCCATCTT TGG Intergenic
No off target data available for this crispr