ID: 1173747081

View in Genome Browser
Species Human (GRCh38)
Location 20:45445947-45445969
Sequence GTGTTTGAGCAGCAGCGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173747079_1173747081 -3 Left 1173747079 20:45445927-45445949 CCAGGAAGACTGTGCCTGATGTG 0: 1
1: 0
2: 3
3: 14
4: 205
Right 1173747081 20:45445947-45445969 GTGTTTGAGCAGCAGCGATGAGG 0: 1
1: 0
2: 0
3: 24
4: 160
1173747077_1173747081 -1 Left 1173747077 20:45445925-45445947 CCCCAGGAAGACTGTGCCTGATG 0: 1
1: 0
2: 4
3: 13
4: 166
Right 1173747081 20:45445947-45445969 GTGTTTGAGCAGCAGCGATGAGG 0: 1
1: 0
2: 0
3: 24
4: 160
1173747078_1173747081 -2 Left 1173747078 20:45445926-45445948 CCCAGGAAGACTGTGCCTGATGT 0: 1
1: 0
2: 2
3: 11
4: 128
Right 1173747081 20:45445947-45445969 GTGTTTGAGCAGCAGCGATGAGG 0: 1
1: 0
2: 0
3: 24
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173747081 Original CRISPR GTGTTTGAGCAGCAGCGATG AGG Intergenic
900186597 1:1335946-1335968 GTGTCTGAGCAGCCGTGTTGGGG - Exonic
904599730 1:31666787-31666809 GTGTTTGGGCACCATCGAAGCGG - Intronic
904609779 1:31719205-31719227 GTGTTTGAGGAGCAGAGAGGAGG + Intergenic
905713663 1:40129491-40129513 GTGTTTGAGAAACAGCGACTAGG + Intergenic
906542929 1:46602109-46602131 GTGTTTGAGAAACAGAGATTTGG + Intronic
909749883 1:79145627-79145649 GTGTTTTATCATCAGCTATGTGG + Intergenic
910951460 1:92653107-92653129 GGACTTGAGCAGCAGCGATAGGG + Intronic
912729160 1:112086534-112086556 GTGTTAGAGCAGCAGCTTTGTGG - Intergenic
913274963 1:117128023-117128045 ATGTTTGAGCAACAGTGAGGAGG + Intergenic
913422072 1:118681095-118681117 GTGTTAGAGGAACAGCAATGAGG - Intergenic
917695728 1:177521238-177521260 GTGTTGGAGGAGCAGCAAGGAGG - Intergenic
917994125 1:180417281-180417303 GTGTTTGAGCAGAGGGAATGTGG - Intronic
922743594 1:228030677-228030699 GTGTTTGAGAAGCAGCCAAGAGG - Intronic
924650014 1:245917478-245917500 CTGGTGGAGCAGCAGCAATGAGG - Intronic
1062975367 10:1678770-1678792 GTGTTGGAACAGCCGAGATGTGG - Intronic
1063248470 10:4248632-4248654 GATTTTGAGCAGCAGCTAGGAGG - Intergenic
1067061663 10:43080969-43080991 GGGTTTGGGCATCAGGGATGGGG + Intronic
1067254680 10:44625149-44625171 GTGTTTGAGCAGTAGCAGTAAGG - Intergenic
1068782764 10:60939494-60939516 GTGTGTGGGCAGCAGGGAAGAGG - Intronic
1069722583 10:70559308-70559330 GTGTTTGAGGAGCAGAGCTAGGG + Intronic
1070948581 10:80412999-80413021 GGGTTTGGGCAGCAGCAGTGAGG + Intronic
1073304373 10:102491585-102491607 GTGTTGGAGCAGCAGGACTGTGG - Intronic
1077166346 11:1141161-1141183 GTGTTTCAACACCAGGGATGGGG - Intergenic
1082559436 11:54601091-54601113 GTGTCTGAGCAGCTGCTCTGTGG + Intergenic
1083553250 11:63606722-63606744 GTGTCTGAGCAACAGCAAGGAGG + Intronic
1084578981 11:70010689-70010711 GTGTTTGAGGGACAGTGATGAGG - Intergenic
1088989423 11:114939010-114939032 GAGTTGGAGCAGCTGAGATGAGG - Intergenic
1089419400 11:118319859-118319881 GTGTTTAAGGAGCAGGGAGGAGG - Intergenic
1089852875 11:121515498-121515520 GTGTTTTAGGAGCAGGGAGGAGG + Intronic
1097190834 12:57218670-57218692 GTGTGTGAGCTGCAGCTGTGGGG + Intronic
1098504369 12:71232229-71232251 GTGTTCAAGAAACAGCGATGGGG - Intronic
1098823571 12:75264879-75264901 GTGTTTGAAAAGCAGTGAGGTGG - Intergenic
1099957936 12:89369569-89369591 GTGTTTGAGCTGGAGTGCTGCGG - Intergenic
1100661586 12:96705097-96705119 GTGTTAGAGCAGAAGAGTTGTGG + Intronic
1100781332 12:98029820-98029842 GTTTTTGAGGAACAGCAATGAGG - Intergenic
1101739288 12:107487855-107487877 GTATTTGAGCAGCATCCAAGGGG + Intronic
1106552545 13:30784698-30784720 GTGTTTGAGAAGCAGAAAGGGGG + Intergenic
1106901421 13:34358024-34358046 GAGTTTGAGCATCAGGGATGGGG - Intergenic
1109462408 13:62678963-62678985 ATATTTGAGAAGCAGGGATGGGG + Intergenic
1109944078 13:69408543-69408565 GAGTTTGAACAGCCACGATGAGG - Intergenic
1110439861 13:75515869-75515891 GTATGTGAGCAGAAGTGATGGGG + Intergenic
1111948679 13:94692319-94692341 GTGTTTGAGCAGCAGCAAGAAGG + Intergenic
1112347396 13:98601745-98601767 GCGTTTGAGAAACAGCAATGAGG - Intergenic
1112385823 13:98938957-98938979 ACCTTTGAGCAGCAGAGATGTGG - Intronic
1112624581 13:101089492-101089514 GTGTCTGAAAAGCAGCAATGAGG + Intronic
1113815061 13:113163788-113163810 GTGGCTGAGCAGCTGGGATGGGG - Intronic
1118182861 14:63510647-63510669 GTGTTTGAGAAACAGCAAGGAGG + Intronic
1120545918 14:85811243-85811265 GTGTGTGAGGAGCAGCAAAGAGG + Intergenic
1124960178 15:34387899-34387921 GTGTTCCAGCAGCAGCGAAGAGG - Exonic
1124976807 15:34534120-34534142 GTGTTCCAGCAGCAGCGAAGAGG - Exonic
1125948446 15:43729937-43729959 GTGTTTGAGAAACAGCAAAGAGG - Intergenic
1125975417 15:43946798-43946820 GTGTTTGAGGAGCACAGAGGAGG - Intronic
1129926043 15:79365078-79365100 GGGTTTGAGCAGCGGAGACGAGG + Intronic
1130992955 15:88887396-88887418 GTGTTGGAGCAGAGGGGATGTGG - Intronic
1132489133 16:215844-215866 GTGGTGGAGCAGCAGTGTTGTGG - Intronic
1132746800 16:1439575-1439597 GTGTATGAGATGCAGGGATGGGG - Intronic
1133543822 16:6785982-6786004 GTGTTTAAGGAGCAGCTATTTGG - Intronic
1133658349 16:7889169-7889191 GTGTAACAGCAGCAGGGATGAGG + Intergenic
1134749650 16:16615778-16615800 GTGTTTGAGGACCAGCGGGGAGG + Intergenic
1134995820 16:18737846-18737868 GTGTTTGAGGACCAGCGGGGAGG - Intergenic
1135645826 16:24160921-24160943 GTGTTTGAGGAACAGCGAGGAGG + Intronic
1138150173 16:54649647-54649669 ATGTTTGAGGAGCAGCAAGGTGG + Intergenic
1138470794 16:57234151-57234173 GTGTTTCAGGAGCAGCAAGGAGG - Intronic
1139777626 16:69326490-69326512 GTGTTTAAGCAGTAGGAATGAGG - Exonic
1145995060 17:29100249-29100271 CTGTGTGAGAAGCAGCGCTGGGG + Intronic
1152005081 17:77675627-77675649 GGGTTGGAGCAGGAGCAATGTGG - Intergenic
1152340160 17:79720029-79720051 ATGTTTGAGCAGCAGCCTCGTGG - Intergenic
1160507547 18:79435792-79435814 GTGTGTGCGCAGCAGCGACACGG + Intronic
1160699553 19:499183-499205 GTGTTGGAGGAACAGCGAGGAGG - Intronic
1160950994 19:1667388-1667410 GTGTCCAAGCAGCAGCGAGGAGG - Intergenic
1160988414 19:1850834-1850856 GTGTTGGAGGAACAGCGAGGAGG + Intergenic
1161222847 19:3126008-3126030 GTGTTGGAGGAGCAGCGAGGAGG + Intergenic
1161267906 19:3373471-3373493 GTGTTAGAGGAACAGCGAGGAGG - Intronic
1161274897 19:3410480-3410502 GTGTTGGAGGAACAGCGAGGAGG + Intronic
1161291836 19:3498123-3498145 GTGTTGGAGGAACAGCGAGGAGG - Intronic
1161442596 19:4300774-4300796 GTGTTGGAGGAACAGCGAGGAGG + Intronic
1161534747 19:4812045-4812067 GTGTTGGAGGAACAGCGAGGAGG - Intergenic
1161624715 19:5319679-5319701 GTGTTGGAGGAACAGCGAGGAGG - Intronic
1161649891 19:5477987-5478009 GTGTTGGAGGAACAGCGAGGGGG - Intergenic
1161653133 19:5497486-5497508 GTGTTGGAGGAACAGCGAAGAGG + Intergenic
1161658292 19:5529631-5529653 GTGTTTGAGCAGTGGCTCTGTGG + Intergenic
1162410619 19:10503066-10503088 GCGCTTGGGCAGCAGCGACGGGG - Intronic
1162463577 19:10827964-10827986 GTGTTTGAACAGAAGCCAGGTGG + Intronic
1162543004 19:11309438-11309460 GTTTCTGAGCAGTAGCGAGGAGG - Intronic
1163549475 19:17957607-17957629 GTGTTTGAGGAACAGTGAGGAGG + Intronic
1165757235 19:38301031-38301053 GTGTCTGAGGAGCTGCGCTGAGG - Intronic
1166853738 19:45772145-45772167 GTGTTTGAGCACCAGCCCTCTGG - Intronic
1166875577 19:45895214-45895236 GTGTTTGAGGATCAGCAAGGAGG - Intronic
1167470354 19:49672315-49672337 GTGTTTGAGGAGCAGGGAGGAGG + Intronic
1168499448 19:56881050-56881072 ATGTTTGAGCAGCACGGAAGGGG - Intergenic
925599150 2:5590322-5590344 GTGTTTGAGAAGCAGCTAGAAGG + Intergenic
925934763 2:8745622-8745644 GTGTTTTTGTAGTAGCGATGGGG - Intronic
926003781 2:9355454-9355476 GTGTGTGTGCAGCAGGGAGGCGG - Intronic
926057150 2:9780587-9780609 GTGTTTCAACAGCAGTGTTGAGG - Intergenic
927185222 2:20477432-20477454 GTGTTCGAGCAGCTGCTGTGTGG + Intergenic
928504943 2:31941223-31941245 GTGTTTGAGGAGAAGCAAGGAGG - Intronic
929627100 2:43420656-43420678 GTTTTTGAGCAGAAGGAATGAGG - Intronic
929905608 2:46043608-46043630 GTGTTTGGGCAGTGGGGATGTGG + Intronic
930531105 2:52589481-52589503 GTTTTTGACCAGAAACGATGGGG + Intergenic
931226866 2:60339345-60339367 ATGTTGGAGGAGCAGCGAGGTGG - Intergenic
931876668 2:66520892-66520914 GTGTTTGAGAGGCAGCGTGGTGG - Intronic
932121380 2:69103656-69103678 GTGGTTGACCAGGAGAGATGGGG + Intronic
933606179 2:84386553-84386575 GTGTTTGAGCAGGAGAGATTAGG + Intergenic
936902859 2:117503803-117503825 GTGTCTGAGCAGCAGCAAAGTGG + Intergenic
944054156 2:195505512-195505534 AAGTTTGAGAAACAGCGATGTGG - Intergenic
945224845 2:207523107-207523129 GTGTTTGAGAAACAGCAAGGAGG + Intergenic
948533485 2:238629142-238629164 GTGGGGGAACAGCAGCGATGAGG + Intergenic
1168980425 20:1998871-1998893 GTGTTTGAGGAGCAGCAGGGAGG - Intergenic
1171252717 20:23661712-23661734 GTGTTTGATGAGCAGAGCTGAGG + Intergenic
1171387219 20:24778597-24778619 GTGTGTGGGAAGCAGTGATGAGG - Intergenic
1171956542 20:31468211-31468233 GGGTTTGAACAGCAGCAAGGAGG - Intronic
1172331015 20:34076144-34076166 GTGTTAGAGCAGCAGAACTGTGG - Intronic
1173747081 20:45445947-45445969 GTGTTTGAGCAGCAGCGATGAGG + Intergenic
1174112703 20:48207182-48207204 GTGTTTGAGGAACAGCAATGAGG - Intergenic
1174217126 20:48924548-48924570 GTGTATAAGGAGCAGCTATGTGG + Intronic
1175314583 20:58038565-58038587 GTGTTTGAGGATCAGCAAGGGGG - Intergenic
1180996081 22:19965996-19966018 GAGTTTCAGCAGCTGTGATGTGG + Intronic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1182056006 22:27355154-27355176 GTGTTTTAGTAGTAGAGATGGGG - Intergenic
1184548300 22:45189005-45189027 CTGTTTGAGCAGCACAGAGGAGG + Intergenic
1184992567 22:48180680-48180702 AGGTTTGGGCAGCTGCGATGCGG + Intergenic
950266591 3:11577709-11577731 GTGTTTAAGCAGCAGCTGTGTGG - Intronic
955906449 3:63812877-63812899 GTGGTAGAGCAGCAGAGGTGGGG - Intergenic
956366480 3:68508967-68508989 GTGTTTGAGAAACAGCAATGAGG + Intronic
959120771 3:102229613-102229635 GTGTTTGATCAGCAGCGCTTAGG + Intronic
959930137 3:111971639-111971661 GTGTATGAGAAGCAGGGGTGGGG - Intronic
960051434 3:113242441-113242463 GTGTTTTAGCAGAAGCTCTGTGG + Intronic
960947099 3:122974284-122974306 GTGTGTGTGCAGGAGCGAGGGGG - Intronic
962575920 3:136754663-136754685 GTGTTTGAGCTGCAGCTTTCTGG - Intergenic
964172287 3:153785032-153785054 GTGTGTGAGCTCCAACGATGAGG + Intergenic
966571323 3:181446951-181446973 TTGATTGAGCAACAGAGATGAGG + Intergenic
970102944 4:12545986-12546008 GTGTTTGAGGAACAGTTATGAGG - Intergenic
971270680 4:25141857-25141879 GTATTTGAGAAGCAGCAAGGAGG - Intronic
974569049 4:63620109-63620131 GTGTTTGACAACCAGCTATGTGG - Intergenic
974772843 4:66438047-66438069 ATGTTTGATAAGCAGAGATGTGG - Intergenic
975784906 4:77877490-77877512 GTGTTTCAGTGGCAGTGATGGGG + Intronic
976352848 4:84080296-84080318 GTATTTTAGGAGCAGAGATGAGG + Intergenic
982058622 4:151579342-151579364 GTGTTGGGGCAGCGGCTATGTGG + Intronic
985723041 5:1500834-1500856 GTGTGAGAGCAGCAGCAATGAGG - Intronic
987288762 5:16487987-16488009 CTGTTTAAGCAGCAGCTGTGTGG + Intronic
987309120 5:16666173-16666195 GTGTTTGAGCTGGAGTGCTGCGG - Exonic
987416086 5:17663354-17663376 ATGTTTGAGCAGCTGCTCTGTGG + Intergenic
989233946 5:39122335-39122357 CTGTTTCATCAGCAGAGATGAGG - Exonic
992857814 5:80881255-80881277 GTGTTTGAGCAGAGGGTATGTGG - Intergenic
995708297 5:115008360-115008382 GTCTTTGAGGAGCAGTGAAGAGG - Intergenic
997655876 5:135554005-135554027 CTGTTTGAGCAGCCACGAGGTGG + Intergenic
997824486 5:137094018-137094040 GTGTTTAAGGAGTAGCAATGGGG + Intronic
997948482 5:138223014-138223036 GTGTTTGCTCAAGAGCGATGTGG + Intergenic
998471822 5:142389640-142389662 GTGTTTGAGCAACAGTGAGGAGG + Intergenic
1000496657 5:161992485-161992507 GTGTTTGAGAAACAGAGATGGGG + Intergenic
1005640530 6:27792096-27792118 GGGTATGAGAAGCAGGGATGAGG - Intergenic
1007750765 6:44069836-44069858 GTGTTTGAGAAGTACTGATGAGG - Intergenic
1008680366 6:53865599-53865621 TTGTTTTAACATCAGCGATGTGG + Intronic
1011627108 6:89291576-89291598 GTGTGTGAGCACCAGCGGTGAGG - Intronic
1012635386 6:101532173-101532195 GTGTTTGAGGAGCTGTGATTAGG - Intronic
1014125521 6:117772759-117772781 GGGTTTGAGGAGCATCCATGGGG - Intergenic
1014963253 6:127713758-127713780 GTTTTTGAGAAACAGCTATGAGG + Intronic
1015985347 6:138879053-138879075 GTGTTTCAGCAGCAGGCAGGAGG - Intronic
1017561043 6:155628170-155628192 GTGTTTGGGGAGCAGGGATGGGG - Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1023841550 7:44101271-44101293 GTGTCTGAGCTGCTGCCATGGGG + Intergenic
1024307944 7:47943887-47943909 GTGAGTGAGCAGCAGGAATGGGG - Intronic
1025238446 7:57251183-57251205 GTGTTAGAGCAGCCTCCATGGGG - Intergenic
1025241849 7:57283371-57283393 GTGTTTGGGGAGCAGCAATGAGG - Intergenic
1026959451 7:74399127-74399149 GAGTTTGTGCAGGAGCGAGGAGG + Intronic
1029700469 7:102243392-102243414 GAGTTTGAGCTGCAGAGATCTGG + Intronic
1032418931 7:131762192-131762214 GTGTTTGAGAAACAGCAAGGAGG + Intergenic
1035026201 7:155827995-155828017 TTGTTTGTGCAGGAGAGATGTGG + Intergenic
1035097324 7:156366028-156366050 GAGTTTGAGAAGCAGGGCTGAGG + Intergenic
1036411590 8:8506670-8506692 GGGTTTGAGCAGCAGGGCAGAGG + Intergenic
1038223884 8:25636647-25636669 GGGTTTGAGGAGCAGCAAGGAGG - Intergenic
1041111987 8:54491884-54491906 GTGTTTCAGAAGCAATGATGAGG - Intergenic
1041214598 8:55587126-55587148 GTGTTTGTGCAGGAGTGTTGAGG - Intergenic
1048718164 8:137291660-137291682 GTGTTTGAGAAGCAGTGAGGAGG - Intergenic
1049326424 8:142023781-142023803 GTGTTTGAGCGGCAGCAGCGCGG - Intergenic
1054870119 9:70041816-70041838 GTGTTTGAGGATCAGCCAAGAGG + Intergenic
1055769008 9:79696061-79696083 GCTTTTCAGCAGCAGCAATGTGG + Intronic
1058875855 9:109244309-109244331 GAGTTTGAGAAGAAGGGATGAGG + Intronic
1061166533 9:128925888-128925910 GTCTGGGAGCAGCAGCGCTGAGG - Intronic
1062001906 9:134220346-134220368 GTGGGTGAGCAGGAGCGTTGGGG + Intergenic
1186476203 X:9859603-9859625 GTGTGTGCACAGCAGCGATGGGG + Intronic
1187688618 X:21841116-21841138 GTGTTTGAAAAGCACTGATGTGG + Intronic
1190012905 X:46800725-46800747 GTGTTTGAGCATGAGCTGTGAGG - Intergenic
1196819765 X:119693248-119693270 GGGTTGGAGCAGCGGCGAGGGGG - Exonic
1201903912 Y:19069984-19070006 GTGTGTAAGCAGCAGTGACGTGG - Intergenic