ID: 1173748968

View in Genome Browser
Species Human (GRCh38)
Location 20:45461268-45461290
Sequence TGGCAAACATCAGTGTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173748963_1173748968 5 Left 1173748963 20:45461240-45461262 CCTGCAGGCTTGTACTAAGGACC No data
Right 1173748968 20:45461268-45461290 TGGCAAACATCAGTGTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173748968 Original CRISPR TGGCAAACATCAGTGTTTGA GGG Intergenic
No off target data available for this crispr