ID: 1173750350

View in Genome Browser
Species Human (GRCh38)
Location 20:45470785-45470807
Sequence ATGTCCCGGCTGTGCGTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173750350_1173750353 -6 Left 1173750350 20:45470785-45470807 CCGGGCACGCACAGCCGGGACAT No data
Right 1173750353 20:45470802-45470824 GGACATTGTTCCCCGCGGCCTGG No data
1173750350_1173750359 4 Left 1173750350 20:45470785-45470807 CCGGGCACGCACAGCCGGGACAT No data
Right 1173750359 20:45470812-45470834 CCCCGCGGCCTGGGGACCCGGGG No data
1173750350_1173750356 2 Left 1173750350 20:45470785-45470807 CCGGGCACGCACAGCCGGGACAT No data
Right 1173750356 20:45470810-45470832 TTCCCCGCGGCCTGGGGACCCGG No data
1173750350_1173750355 -4 Left 1173750350 20:45470785-45470807 CCGGGCACGCACAGCCGGGACAT No data
Right 1173750355 20:45470804-45470826 ACATTGTTCCCCGCGGCCTGGGG No data
1173750350_1173750366 27 Left 1173750350 20:45470785-45470807 CCGGGCACGCACAGCCGGGACAT No data
Right 1173750366 20:45470835-45470857 CCGCAGTTTCCTTCTCGAACCGG No data
1173750350_1173750357 3 Left 1173750350 20:45470785-45470807 CCGGGCACGCACAGCCGGGACAT No data
Right 1173750357 20:45470811-45470833 TCCCCGCGGCCTGGGGACCCGGG No data
1173750350_1173750354 -5 Left 1173750350 20:45470785-45470807 CCGGGCACGCACAGCCGGGACAT No data
Right 1173750354 20:45470803-45470825 GACATTGTTCCCCGCGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173750350 Original CRISPR ATGTCCCGGCTGTGCGTGCC CGG (reversed) Intronic