ID: 1173750352

View in Genome Browser
Species Human (GRCh38)
Location 20:45470799-45470821
Sequence GGCCGCGGGGAACAATGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173750352_1173750359 -10 Left 1173750352 20:45470799-45470821 CCGGGACATTGTTCCCCGCGGCC No data
Right 1173750359 20:45470812-45470834 CCCCGCGGCCTGGGGACCCGGGG No data
1173750352_1173750366 13 Left 1173750352 20:45470799-45470821 CCGGGACATTGTTCCCCGCGGCC No data
Right 1173750366 20:45470835-45470857 CCGCAGTTTCCTTCTCGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173750352 Original CRISPR GGCCGCGGGGAACAATGTCC CGG (reversed) Intronic