ID: 1173750355 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:45470804-45470826 |
Sequence | ACATTGTTCCCCGCGGCCTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1173750350_1173750355 | -4 | Left | 1173750350 | 20:45470785-45470807 | CCGGGCACGCACAGCCGGGACAT | No data | ||
Right | 1173750355 | 20:45470804-45470826 | ACATTGTTCCCCGCGGCCTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1173750355 | Original CRISPR | ACATTGTTCCCCGCGGCCTG GGG | Intronic | ||