ID: 1173750357

View in Genome Browser
Species Human (GRCh38)
Location 20:45470811-45470833
Sequence TCCCCGCGGCCTGGGGACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173750350_1173750357 3 Left 1173750350 20:45470785-45470807 CCGGGCACGCACAGCCGGGACAT No data
Right 1173750357 20:45470811-45470833 TCCCCGCGGCCTGGGGACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173750357 Original CRISPR TCCCCGCGGCCTGGGGACCC GGG Intronic