ID: 1173750358

View in Genome Browser
Species Human (GRCh38)
Location 20:45470812-45470834
Sequence CCCCGGGTCCCCAGGCCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173750358_1173750370 19 Left 1173750358 20:45470812-45470834 CCCCGCGGCCTGGGGACCCGGGG No data
Right 1173750370 20:45470854-45470876 CCGGCCGAAGCCTGCCCTGCGGG No data
1173750358_1173750366 0 Left 1173750358 20:45470812-45470834 CCCCGCGGCCTGGGGACCCGGGG No data
Right 1173750366 20:45470835-45470857 CCGCAGTTTCCTTCTCGAACCGG No data
1173750358_1173750372 28 Left 1173750358 20:45470812-45470834 CCCCGCGGCCTGGGGACCCGGGG No data
Right 1173750372 20:45470863-45470885 GCCTGCCCTGCGGGAAAGCCCGG No data
1173750358_1173750368 18 Left 1173750358 20:45470812-45470834 CCCCGCGGCCTGGGGACCCGGGG No data
Right 1173750368 20:45470853-45470875 ACCGGCCGAAGCCTGCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173750358 Original CRISPR CCCCGGGTCCCCAGGCCGCG GGG (reversed) Intronic