ID: 1173750359

View in Genome Browser
Species Human (GRCh38)
Location 20:45470812-45470834
Sequence CCCCGCGGCCTGGGGACCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173750350_1173750359 4 Left 1173750350 20:45470785-45470807 CCGGGCACGCACAGCCGGGACAT No data
Right 1173750359 20:45470812-45470834 CCCCGCGGCCTGGGGACCCGGGG No data
1173750352_1173750359 -10 Left 1173750352 20:45470799-45470821 CCGGGACATTGTTCCCCGCGGCC No data
Right 1173750359 20:45470812-45470834 CCCCGCGGCCTGGGGACCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173750359 Original CRISPR CCCCGCGGCCTGGGGACCCG GGG Intronic