ID: 1173750360

View in Genome Browser
Species Human (GRCh38)
Location 20:45470813-45470835
Sequence GCCCCGGGTCCCCAGGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173750360_1173750372 27 Left 1173750360 20:45470813-45470835 CCCGCGGCCTGGGGACCCGGGGC No data
Right 1173750372 20:45470863-45470885 GCCTGCCCTGCGGGAAAGCCCGG No data
1173750360_1173750366 -1 Left 1173750360 20:45470813-45470835 CCCGCGGCCTGGGGACCCGGGGC No data
Right 1173750366 20:45470835-45470857 CCGCAGTTTCCTTCTCGAACCGG No data
1173750360_1173750368 17 Left 1173750360 20:45470813-45470835 CCCGCGGCCTGGGGACCCGGGGC No data
Right 1173750368 20:45470853-45470875 ACCGGCCGAAGCCTGCCCTGCGG No data
1173750360_1173750370 18 Left 1173750360 20:45470813-45470835 CCCGCGGCCTGGGGACCCGGGGC No data
Right 1173750370 20:45470854-45470876 CCGGCCGAAGCCTGCCCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173750360 Original CRISPR GCCCCGGGTCCCCAGGCCGC GGG (reversed) Intronic