ID: 1173750361

View in Genome Browser
Species Human (GRCh38)
Location 20:45470814-45470836
Sequence GGCCCCGGGTCCCCAGGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173750361_1173750372 26 Left 1173750361 20:45470814-45470836 CCGCGGCCTGGGGACCCGGGGCC No data
Right 1173750372 20:45470863-45470885 GCCTGCCCTGCGGGAAAGCCCGG No data
1173750361_1173750368 16 Left 1173750361 20:45470814-45470836 CCGCGGCCTGGGGACCCGGGGCC No data
Right 1173750368 20:45470853-45470875 ACCGGCCGAAGCCTGCCCTGCGG No data
1173750361_1173750370 17 Left 1173750361 20:45470814-45470836 CCGCGGCCTGGGGACCCGGGGCC No data
Right 1173750370 20:45470854-45470876 CCGGCCGAAGCCTGCCCTGCGGG No data
1173750361_1173750366 -2 Left 1173750361 20:45470814-45470836 CCGCGGCCTGGGGACCCGGGGCC No data
Right 1173750366 20:45470835-45470857 CCGCAGTTTCCTTCTCGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173750361 Original CRISPR GGCCCCGGGTCCCCAGGCCG CGG (reversed) Intronic