ID: 1173750362

View in Genome Browser
Species Human (GRCh38)
Location 20:45470820-45470842
Sequence AACTGCGGCCCCGGGTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173750362_1173750370 11 Left 1173750362 20:45470820-45470842 CCTGGGGACCCGGGGCCGCAGTT No data
Right 1173750370 20:45470854-45470876 CCGGCCGAAGCCTGCCCTGCGGG No data
1173750362_1173750372 20 Left 1173750362 20:45470820-45470842 CCTGGGGACCCGGGGCCGCAGTT No data
Right 1173750372 20:45470863-45470885 GCCTGCCCTGCGGGAAAGCCCGG No data
1173750362_1173750376 27 Left 1173750362 20:45470820-45470842 CCTGGGGACCCGGGGCCGCAGTT No data
Right 1173750376 20:45470870-45470892 CTGCGGGAAAGCCCGGAGCCTGG No data
1173750362_1173750368 10 Left 1173750362 20:45470820-45470842 CCTGGGGACCCGGGGCCGCAGTT No data
Right 1173750368 20:45470853-45470875 ACCGGCCGAAGCCTGCCCTGCGG No data
1173750362_1173750378 29 Left 1173750362 20:45470820-45470842 CCTGGGGACCCGGGGCCGCAGTT No data
Right 1173750378 20:45470872-45470894 GCGGGAAAGCCCGGAGCCTGGGG No data
1173750362_1173750366 -8 Left 1173750362 20:45470820-45470842 CCTGGGGACCCGGGGCCGCAGTT No data
Right 1173750366 20:45470835-45470857 CCGCAGTTTCCTTCTCGAACCGG No data
1173750362_1173750377 28 Left 1173750362 20:45470820-45470842 CCTGGGGACCCGGGGCCGCAGTT No data
Right 1173750377 20:45470871-45470893 TGCGGGAAAGCCCGGAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173750362 Original CRISPR AACTGCGGCCCCGGGTCCCC AGG (reversed) Intronic