ID: 1173750366

View in Genome Browser
Species Human (GRCh38)
Location 20:45470835-45470857
Sequence CCGCAGTTTCCTTCTCGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173750362_1173750366 -8 Left 1173750362 20:45470820-45470842 CCTGGGGACCCGGGGCCGCAGTT No data
Right 1173750366 20:45470835-45470857 CCGCAGTTTCCTTCTCGAACCGG No data
1173750350_1173750366 27 Left 1173750350 20:45470785-45470807 CCGGGCACGCACAGCCGGGACAT No data
Right 1173750366 20:45470835-45470857 CCGCAGTTTCCTTCTCGAACCGG No data
1173750361_1173750366 -2 Left 1173750361 20:45470814-45470836 CCGCGGCCTGGGGACCCGGGGCC No data
Right 1173750366 20:45470835-45470857 CCGCAGTTTCCTTCTCGAACCGG No data
1173750352_1173750366 13 Left 1173750352 20:45470799-45470821 CCGGGACATTGTTCCCCGCGGCC No data
Right 1173750366 20:45470835-45470857 CCGCAGTTTCCTTCTCGAACCGG No data
1173750360_1173750366 -1 Left 1173750360 20:45470813-45470835 CCCGCGGCCTGGGGACCCGGGGC No data
Right 1173750366 20:45470835-45470857 CCGCAGTTTCCTTCTCGAACCGG No data
1173750358_1173750366 0 Left 1173750358 20:45470812-45470834 CCCCGCGGCCTGGGGACCCGGGG No data
Right 1173750366 20:45470835-45470857 CCGCAGTTTCCTTCTCGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173750366 Original CRISPR CCGCAGTTTCCTTCTCGAAC CGG Intronic