ID: 1173750368

View in Genome Browser
Species Human (GRCh38)
Location 20:45470853-45470875
Sequence ACCGGCCGAAGCCTGCCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173750364_1173750368 1 Left 1173750364 20:45470829-45470851 CCGGGGCCGCAGTTTCCTTCTCG No data
Right 1173750368 20:45470853-45470875 ACCGGCCGAAGCCTGCCCTGCGG No data
1173750363_1173750368 2 Left 1173750363 20:45470828-45470850 CCCGGGGCCGCAGTTTCCTTCTC No data
Right 1173750368 20:45470853-45470875 ACCGGCCGAAGCCTGCCCTGCGG No data
1173750360_1173750368 17 Left 1173750360 20:45470813-45470835 CCCGCGGCCTGGGGACCCGGGGC No data
Right 1173750368 20:45470853-45470875 ACCGGCCGAAGCCTGCCCTGCGG No data
1173750361_1173750368 16 Left 1173750361 20:45470814-45470836 CCGCGGCCTGGGGACCCGGGGCC No data
Right 1173750368 20:45470853-45470875 ACCGGCCGAAGCCTGCCCTGCGG No data
1173750365_1173750368 -5 Left 1173750365 20:45470835-45470857 CCGCAGTTTCCTTCTCGAACCGG No data
Right 1173750368 20:45470853-45470875 ACCGGCCGAAGCCTGCCCTGCGG No data
1173750358_1173750368 18 Left 1173750358 20:45470812-45470834 CCCCGCGGCCTGGGGACCCGGGG No data
Right 1173750368 20:45470853-45470875 ACCGGCCGAAGCCTGCCCTGCGG No data
1173750362_1173750368 10 Left 1173750362 20:45470820-45470842 CCTGGGGACCCGGGGCCGCAGTT No data
Right 1173750368 20:45470853-45470875 ACCGGCCGAAGCCTGCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173750368 Original CRISPR ACCGGCCGAAGCCTGCCCTG CGG Intronic