ID: 1173751453

View in Genome Browser
Species Human (GRCh38)
Location 20:45479979-45480001
Sequence TCCCCAGCTCGGCCTCTGTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 234}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173751448_1173751453 -3 Left 1173751448 20:45479959-45479981 CCCCAGGTGAACATTAACTTTCC 0: 1
1: 0
2: 1
3: 13
4: 189
Right 1173751453 20:45479979-45480001 TCCCCAGCTCGGCCTCTGTCGGG 0: 1
1: 0
2: 1
3: 23
4: 234
1173751443_1173751453 19 Left 1173751443 20:45479937-45479959 CCCAGATAAGGAGGGTTCCTGCC 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1173751453 20:45479979-45480001 TCCCCAGCTCGGCCTCTGTCGGG 0: 1
1: 0
2: 1
3: 23
4: 234
1173751440_1173751453 29 Left 1173751440 20:45479927-45479949 CCTTTTTCTACCCAGATAAGGAG 0: 1
1: 0
2: 2
3: 17
4: 154
Right 1173751453 20:45479979-45480001 TCCCCAGCTCGGCCTCTGTCGGG 0: 1
1: 0
2: 1
3: 23
4: 234
1173751447_1173751453 -2 Left 1173751447 20:45479958-45479980 CCCCCAGGTGAACATTAACTTTC 0: 1
1: 0
2: 1
3: 35
4: 168
Right 1173751453 20:45479979-45480001 TCCCCAGCTCGGCCTCTGTCGGG 0: 1
1: 0
2: 1
3: 23
4: 234
1173751449_1173751453 -4 Left 1173751449 20:45479960-45479982 CCCAGGTGAACATTAACTTTCCC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1173751453 20:45479979-45480001 TCCCCAGCTCGGCCTCTGTCGGG 0: 1
1: 0
2: 1
3: 23
4: 234
1173751450_1173751453 -5 Left 1173751450 20:45479961-45479983 CCAGGTGAACATTAACTTTCCCC 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1173751453 20:45479979-45480001 TCCCCAGCTCGGCCTCTGTCGGG 0: 1
1: 0
2: 1
3: 23
4: 234
1173751446_1173751453 2 Left 1173751446 20:45479954-45479976 CCTGCCCCCAGGTGAACATTAAC 0: 1
1: 1
2: 15
3: 15
4: 183
Right 1173751453 20:45479979-45480001 TCCCCAGCTCGGCCTCTGTCGGG 0: 1
1: 0
2: 1
3: 23
4: 234
1173751444_1173751453 18 Left 1173751444 20:45479938-45479960 CCAGATAAGGAGGGTTCCTGCCC 0: 1
1: 0
2: 2
3: 5
4: 103
Right 1173751453 20:45479979-45480001 TCCCCAGCTCGGCCTCTGTCGGG 0: 1
1: 0
2: 1
3: 23
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173751453 Original CRISPR TCCCCAGCTCGGCCTCTGTC GGG Exonic
900115873 1:1027724-1027746 TGCCCAGATGGGACTCTGTCTGG + Intronic
900341592 1:2192034-2192056 TCCCCAGACCCGCCTCTGCCAGG + Intronic
900405948 1:2493032-2493054 CCCCCAGCCCTGCCTCTGTCAGG - Intronic
900437241 1:2636856-2636878 TCACCAGCTCAGCCTGTGGCTGG + Intronic
901827045 1:11868991-11869013 TCCCCAGCTCTCTCTGTGTCAGG + Intergenic
903743475 1:25571883-25571905 GCCCCAGCACGGCCTGTCTCAGG + Intergenic
904084114 1:27892081-27892103 TCTCCAGCTCTGCATATGTCTGG - Exonic
904999865 1:34659641-34659663 TCCTCAGCCCTGCCTCTGGCCGG + Intergenic
905106064 1:35564349-35564371 TCCCTAGCTCTGCCTCACTCTGG + Intronic
906693529 1:47809064-47809086 TCCTCTGCACGTCCTCTGTCTGG + Intronic
908004188 1:59711493-59711515 TGCCCAGCTTGGGCTCTTTCTGG + Intronic
913255503 1:116949708-116949730 TCCCCAGCTTGGGATCTATCTGG - Intronic
915635651 1:157184730-157184752 TCCCCAGCTTGGCCTCAGCTGGG + Intergenic
916653035 1:166848632-166848654 TTCCCAGCTCTGCCACTTTCTGG + Intronic
919749862 1:201030775-201030797 TCCCCAGCCTGGCCTCTTGCTGG - Intergenic
919782403 1:201229312-201229334 TCCCCAACTCAGACTCTTTCTGG - Intergenic
920113106 1:203600875-203600897 TCCCAGGCTAGGCCCCTGTCTGG - Intergenic
920258183 1:204670828-204670850 TCCCCAGCCCTGCTTCAGTCTGG - Intronic
922674914 1:227544086-227544108 CCCCCAGCTCAGCCCCTGCCAGG + Intergenic
1063371428 10:5525214-5525236 CCCGCAGCTCGGCCTCCGTGGGG - Exonic
1063382096 10:5591872-5591894 CCCCCAGCCCAGCCTCTGTGTGG + Intergenic
1064720785 10:18226532-18226554 TCCCCATCTCTGCCTCTTACTGG - Intronic
1064735850 10:18381113-18381135 TCCCCAGCTGGCCCTGTGTCTGG - Intronic
1069597897 10:69684490-69684512 TCCCCGCCCCGGCCTCTATCAGG + Intergenic
1069774661 10:70919436-70919458 GCCCCCGCCCGGCCTCTTTCTGG + Intergenic
1070508373 10:77137555-77137577 TCCCCAGCTTGGTCACTGTGAGG + Intronic
1070782679 10:79146698-79146720 GCCCCAGCCCTGCCTGTGTCTGG - Intronic
1072976853 10:100066300-100066322 GCCCCAACTTGGCCTCTCTCTGG + Intronic
1076383971 10:130044263-130044285 TTCCCAGCTCGGCCCCCATCAGG - Intergenic
1076570999 10:131432709-131432731 GCCCCTCCTCAGCCTCTGTCTGG - Intergenic
1077228353 11:1448020-1448042 ACCCCTCCTCGGCCTCTGCCTGG - Intronic
1077432455 11:2522507-2522529 ACCCCAGCTCGGCACCTGTGAGG + Intronic
1077514797 11:2995036-2995058 TTCCCAGCGCTGCCTCTGCCAGG + Intergenic
1079017262 11:16879663-16879685 TGCCCAGCTCTGCCTGTGCCAGG - Intronic
1080418857 11:32092694-32092716 TCCCCAGCCCTGCCTCCATCTGG - Intronic
1080808871 11:35682442-35682464 GCCCCAGCTCTGCAGCTGTCAGG + Intronic
1083269657 11:61565388-61565410 TCCCCAACTCTGCCTCTTTCTGG - Intronic
1083749132 11:64751711-64751733 GTCCCAGCCCAGCCTCTGTCAGG - Intronic
1083829077 11:65219591-65219613 TCCCCTGCAGGGCCTCTGCCTGG - Intergenic
1084461467 11:69298879-69298901 TCCACCCCACGGCCTCTGTCAGG + Intronic
1084615150 11:70230983-70231005 CCCCAAGCTGGGCCACTGTCTGG - Intergenic
1085436990 11:76514517-76514539 TCCCCAGTTCTGCCTCTTTTTGG - Intronic
1089737689 11:120561412-120561434 TCACCAGCAAGGCCTCTGCCTGG + Intronic
1089938746 11:122393696-122393718 TCCCCACCTCAGCCTCAGCCAGG - Intergenic
1091631069 12:2161362-2161384 GCCCCTGCTCTGCCCCTGTCTGG - Intronic
1091692752 12:2608367-2608389 GTCCCAGCTCGGCCTCTTACTGG - Intronic
1092095218 12:5836667-5836689 TGCCCAGCTCAGCCAGTGTCTGG - Intronic
1092192158 12:6528986-6529008 CCCCCAGCTCGGGGTCTGACAGG - Exonic
1092725741 12:11483961-11483983 ATCCCAGCTCTGCTTCTGTCCGG - Intronic
1093305780 12:17515636-17515658 TCCACATCTCTGCTTCTGTCTGG + Intergenic
1096259673 12:50082836-50082858 TCACAAGCTCTGCCTCTTTCTGG + Exonic
1096481919 12:51947851-51947873 CCCCCAGATAGGCCTGTGTCAGG - Intergenic
1102575882 12:113855910-113855932 TCCCCAGCTCCAGGTCTGTCTGG - Intronic
1103416937 12:120748609-120748631 CCCCCAGCTCTGCCTCACTCAGG + Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1106113872 13:26800609-26800631 TACCCAGCTTGCCCTCAGTCTGG + Intergenic
1108123492 13:47215064-47215086 TCCCCTGCTTGTCCTCTGTTGGG - Intergenic
1109905222 13:68831151-68831173 GCCCCAGTAGGGCCTCTGTCTGG - Intergenic
1110377888 13:74814682-74814704 TCCCCAGCAGGGACTCTGTGTGG - Intergenic
1112166903 13:96929310-96929332 TCCCCAACTTTGCCTCTCTCTGG + Intergenic
1112348643 13:98614253-98614275 TCCCAAGCTCTGCCTCTGGGAGG - Intergenic
1112840672 13:103573572-103573594 TCACCAGCTCAGCCTGTGGCTGG - Intergenic
1113748788 13:112764551-112764573 GCCCCACCTGGGACTCTGTCTGG - Intronic
1113848491 13:113405147-113405169 TCCCCAGGTCCGCCTGTGTCAGG + Intergenic
1113969672 13:114179281-114179303 GCCCCAGCTGCTCCTCTGTCTGG + Intergenic
1114182028 14:20375673-20375695 TCCCCACCTCGTCCTTTTTCTGG - Intronic
1118401604 14:65384733-65384755 TCACCTTCTCAGCCTCTGTCGGG + Intergenic
1119406625 14:74403130-74403152 TTCCCAGCTCTGCCTGCGTCTGG - Intergenic
1121738799 14:96237160-96237182 TGCCCACCACGGCCTCTTTCAGG + Exonic
1122836322 14:104432661-104432683 TCCCCAGCTCTGGGTCTCTCTGG - Intergenic
1123815567 15:23975195-23975217 TCCCCAGCTGAGCCTCAGCCTGG + Intergenic
1124134554 15:27022722-27022744 TCCCCAGCAAGGCTGCTGTCAGG + Intronic
1124892139 15:33743201-33743223 CCACCAGCTCAGCCTCTGTGTGG + Intronic
1125539857 15:40464077-40464099 TCCCCAGATTGGCCCCTGCCTGG + Intronic
1125556863 15:40592973-40592995 TCCACAACACGGCCTCTGGCAGG - Intergenic
1126434722 15:48624845-48624867 CCCCCGGCTCCGCCTCTGGCCGG - Intronic
1127563663 15:60165471-60165493 TCCCCAGCTCTGCCTGTGATAGG - Intergenic
1128251434 15:66166713-66166735 TTCCCAGATCCGCCTCTGGCTGG + Intronic
1128747388 15:70124084-70124106 TCCCCAGCTGGACCACTGTGAGG + Intergenic
1128799750 15:70489925-70489947 TCCCCAGTTAGGCCACTGTAGGG + Intergenic
1129657233 15:77532307-77532329 TCCCCAGCCCTGCCTCTCTTAGG + Intergenic
1130043743 15:80428180-80428202 TCCACAGTTCTGCCTCTTTCAGG - Intronic
1131263635 15:90903015-90903037 GCCCGAGCCCGGCCTCTGTCGGG - Exonic
1131557569 15:93413071-93413093 TTCCCAGCTCGCCATCTGGCTGG - Intergenic
1132576302 16:665943-665965 TCCCCAGAGCTGCCTCTGCCTGG + Exonic
1132889090 16:2195593-2195615 TCCCCAGCTTGCCCTATGGCCGG - Intronic
1133170267 16:3978597-3978619 TCCCCAGCCCGGCCACTGCCCGG + Intronic
1134838090 16:17378771-17378793 ACCCCAGCTCAGCCTCTTACTGG - Intronic
1136029396 16:27491828-27491850 TCCCCAGCTCTGGCCCTGGCTGG + Intronic
1137240223 16:46649638-46649660 TCCCCAGCACGGCGTCTCCCGGG + Intergenic
1138521120 16:57571365-57571387 GCCCCAGCTCTGCCACTGACTGG - Intronic
1138578943 16:57927079-57927101 CCCCCAGCACTGCCTGTGTCTGG + Intronic
1140207999 16:72949160-72949182 TGCCCATGTCGGCCTCTGCCGGG - Intronic
1140453139 16:75087730-75087752 TCCCTGCCTCTGCCTCTGTCTGG + Intronic
1141342213 16:83213528-83213550 TCACCAGCGGGGCCTGTGTCTGG + Intronic
1141663103 16:85452371-85452393 CCCCCACCTCTCCCTCTGTCTGG + Intergenic
1141862518 16:86727667-86727689 TCCCCAGCCCCACCTCTGCCAGG - Intergenic
1143538677 17:7557212-7557234 GCCCCAGCTCCGCCTCTGCCAGG + Exonic
1144661490 17:17073603-17073625 CTCCCAGCTCGGCCTCTCACCGG - Intronic
1144822978 17:18088364-18088386 ACCCCAGCTCCGCCTCTCTCTGG - Intronic
1145269504 17:21397128-21397150 TCCCCAGCTCTGCCTCTTATAGG + Intronic
1145885914 17:28382378-28382400 TCCCCAGCTGGGCATCTCTCAGG - Intronic
1146691964 17:34882862-34882884 TCACCAGCTCAGCATCTCTCAGG - Intergenic
1146913799 17:36665275-36665297 TCCCCACCTCTGTCCCTGTCCGG + Intergenic
1146915527 17:36676136-36676158 TCCCCACCACAGCCCCTGTCAGG + Intergenic
1147335230 17:39723594-39723616 TCCTCAGCTCCGTCTCTTTCAGG - Exonic
1147911555 17:43859068-43859090 TCCCCAGTTCTGCCTCTTTCAGG - Intronic
1147971502 17:44220842-44220864 TCGCCATCTCGGGCTTTGTCTGG - Intronic
1149019487 17:51946523-51946545 TCCTCATCTTGGCCTCTGGCTGG + Intronic
1150452709 17:65282215-65282237 TACCCATCTGGGCCTATGTCAGG - Intergenic
1150641552 17:66953139-66953161 TCCCCAGCTGAGCCCCTCTCTGG + Intergenic
1152093043 17:78257411-78257433 ACCCCAGCTTGGCCTCTGGGGGG + Intergenic
1152311058 17:79550096-79550118 TCCCCAGCCAGGGCCCTGTCAGG + Intergenic
1152333948 17:79689654-79689676 TTCCCACCTCGGTCTGTGTCCGG + Intergenic
1152600153 17:81258269-81258291 ACCCCAGCTCAGCCTCAGCCCGG + Intronic
1152631944 17:81414387-81414409 GCCCGAGCTCCGCCTCTGTGGGG - Intronic
1152830759 17:82495837-82495859 TCCCCAGCTCTTTCTCTGCCTGG - Intergenic
1154323264 18:13371229-13371251 CCCCCATCTCAGCCTCTGTGTGG - Intronic
1155125355 18:22870012-22870034 TCCCCCACTCCGCCTCTGACAGG - Intronic
1157285356 18:46373818-46373840 GCCCCAGCTCTGCCTTTCTCTGG - Intronic
1161040228 19:2106736-2106758 TCCACATCGCAGCCTCTGTCAGG - Intronic
1161735582 19:5990460-5990482 TCCCCAGCTCCTCCTCGGCCGGG - Intergenic
1161852407 19:6744610-6744632 CCTCCAGCTCGGCCTCCGACAGG - Exonic
1163034831 19:14564470-14564492 TCCCCAGCCCCGCCCCCGTCGGG + Intronic
1163495247 19:17642769-17642791 TGCCCAGCTCTTCCTCTTTCTGG - Intronic
1164096021 19:22010648-22010670 TGCCTAGCTCGACCTCAGTCCGG - Intronic
1165711487 19:38014189-38014211 TGCTCACCTGGGCCTCTGTCAGG + Intronic
1166730683 19:45057488-45057510 TCCCCAGCCCTGCCTTTGTTGGG - Intronic
1167266445 19:48485342-48485364 TCCCCAGCCCGGCCCCTGGAGGG - Exonic
1168310071 19:55455764-55455786 TCCCCAGCTCGGGCACCGTGGGG + Exonic
1168348305 19:55661339-55661361 CCCCCAGCCCGGCCCCTGGCTGG - Intronic
1168413602 19:56155395-56155417 GCATCAGCTCGGCCTCTGCCAGG - Intronic
925072944 2:985493-985515 TCCCCAGCTCCCCCTCTGCTGGG + Intronic
925600741 2:5606532-5606554 TTCCCAGGTTGGCCTCGGTCTGG + Intergenic
927827376 2:26318007-26318029 TCACCAACTCCTCCTCTGTCAGG + Exonic
929967205 2:46544154-46544176 TCCCCCCCACAGCCTCTGTCTGG + Intronic
930857058 2:56030149-56030171 TCTGCAGCTCAGCATCTGTCAGG + Intergenic
931090077 2:58876316-58876338 TCCCCAGCTGTGCCTCTTCCAGG + Intergenic
932720094 2:74132351-74132373 TCCCCAGGACGGCCTCTGTTTGG - Intronic
932722458 2:74147914-74147936 TCCCCCGCTCCGCGTCTTTCGGG - Exonic
934614018 2:95760400-95760422 TCCCCAGCCCTGCCTCAGCCAGG - Intergenic
934646904 2:96064143-96064165 TCCCAAGCCCTGCCTCAGTCAGG + Intergenic
934840302 2:97620225-97620247 TCCCAAGCCCTGCCTCAGTCAGG + Intergenic
935383848 2:102480881-102480903 TCCCAAGCGCAGCCTCTGTGTGG - Intronic
936172067 2:110185447-110185469 TCCTCAGGTGGGCCTCTGACTGG + Intronic
937231083 2:120398632-120398654 TCCCCTGCTTGCCCTCGGTCTGG + Intergenic
942070021 2:172308079-172308101 TCCCCAGCCCAGCCTCTTCCTGG + Intergenic
947118530 2:226795973-226795995 TCCACAGCTCACCTTCTGTCAGG - Exonic
947587501 2:231365595-231365617 TCCCCACCTCTGCCCCTTTCTGG - Intronic
947800990 2:232928359-232928381 TCCGCAGCTCTGCCCCTCTCCGG - Intronic
1170945605 20:20888463-20888485 TCCCCTGCGCGGCCGCTTTCCGG - Intergenic
1172131836 20:32661147-32661169 TCACCAGCTCTGACTCTCTCAGG + Intergenic
1172446437 20:34995896-34995918 TCCCCAGCTCGGCATCCCGCAGG + Intronic
1173443335 20:43096594-43096616 TCCACAGCTCTGCCTGTGTAAGG + Intronic
1173596932 20:44264516-44264538 TCTCCAGCTCCGCCTCAATCTGG - Exonic
1173751453 20:45479979-45480001 TCCCCAGCTCGGCCTCTGTCGGG + Exonic
1176070109 20:63221879-63221901 TGCCCTGCTGGGACTCTGTCTGG - Intergenic
1178486931 21:33025388-33025410 TCCCTAGCTCTTCCTCTGTCTGG - Intergenic
1178971069 21:37177336-37177358 TCCCCAGCCCGGGCTCTGGCTGG - Intronic
1179905055 21:44418415-44418437 TCTCCAGCTTGTTCTCTGTCAGG - Exonic
1180917641 22:19499957-19499979 TCCCCAGCCCTGCCCCTGTCTGG + Intronic
1181341729 22:22186198-22186220 TCACCAGGTCAGCCTCTGGCTGG + Intergenic
1181873596 22:25922633-25922655 GGCCCAGCTCAGCCTCTGACTGG - Intronic
1182870105 22:33638637-33638659 TCCCAAGCTCTACCTCTTTCTGG + Intronic
1183225900 22:36549655-36549677 GCCCCAGCTCTGCCCCTGTGTGG + Intergenic
1183618696 22:38960222-38960244 TACCCAGCACAGCCTCTGTCTGG + Intronic
1183623899 22:38990167-38990189 TACCCAGCACAGCCTCTGTCTGG + Intronic
1183663321 22:39233978-39234000 TGCCCAGCGCGGCCATTGTCCGG - Intronic
1183850534 22:40583400-40583422 TCCCCAGCTTTACCTCTGGCTGG + Intronic
1184272615 22:43393317-43393339 TCCCCTGCTGGGCCCCTCTCAGG + Intergenic
1184654477 22:45934253-45934275 CCCCCAGCTTGGCCTCTCTGAGG + Intronic
1185126955 22:49016714-49016736 AGCCCTGCTCGGCCTCTTTCCGG + Intergenic
1185245744 22:49771826-49771848 TCCCCAGGGAGGCCGCTGTCGGG - Intergenic
1185342767 22:50299106-50299128 TCCCCATCTTGGCCCCTGCCGGG - Intronic
953033073 3:39190618-39190640 ACCCCAGCTCAGCCTCTCCCCGG + Intronic
953231706 3:41071118-41071140 ACCCCAGCTCTGCCACTTTCTGG + Intergenic
954395042 3:50289058-50289080 ACCCCTCCTTGGCCTCTGTCAGG + Intronic
956725026 3:72149930-72149952 ATCCCAGCTCTGCCGCTGTCTGG + Intergenic
956800205 3:72750769-72750791 ACCCCAGCTGGGCCTTTGTAAGG + Exonic
958604388 3:96339138-96339160 GCCCCAGCTGGGACTCTGTATGG - Intergenic
960971837 3:123145444-123145466 TCCCCTGCGCCGCCTCTGTAAGG - Intronic
961455013 3:127019729-127019751 GGGCCAGCTCTGCCTCTGTCAGG - Intronic
961664743 3:128488366-128488388 CCCCTAGCTCGGGCGCTGTCTGG + Intronic
962570272 3:136705958-136705980 CTCCCACCTTGGCCTCTGTCTGG - Intronic
966191590 3:177276778-177276800 GCCCCAGCTCTGCCTCTTACTGG + Intergenic
966863144 3:184241695-184241717 CCCCCAGCTCGGGCTCTGAGGGG + Exonic
966924211 3:184634075-184634097 CCCCAAGCTCAGCCTCTGTTTGG + Intronic
968176224 3:196551550-196551572 TCCCCACCTCGGCCTCTCAAAGG - Intergenic
968624264 4:1619429-1619451 TGCCCAGCTCGGCGTCTCTGGGG + Intronic
969637548 4:8378032-8378054 TCCCCAGCTAGGACTGTGACAGG + Intronic
971244024 4:24912728-24912750 CTCCCAGCTCGGCCTCTCTGGGG + Intronic
972843622 4:42960998-42961020 TCCCCACCTCACCCTCTGACAGG + Intronic
973601770 4:52549416-52549438 TAACCACCTCGGCCTCTGCCAGG + Intergenic
973863823 4:55091902-55091924 TCCCCATCTCAGCCTTTGTTTGG + Intronic
981271062 4:142847110-142847132 TCCTCAGCCCGACCTCTGCCCGG - Intronic
984919770 4:184753115-184753137 TCCCCAGCAGGGCCTGAGTCAGG - Intergenic
985236570 4:187881597-187881619 GCCCCAGCTCAGGCACTGTCAGG - Intergenic
986258682 5:6123784-6123806 TCCCCAGCAGGGACTCTGTGTGG + Intergenic
986658966 5:10041995-10042017 TCACCAGCTGGGCCCCTGTTTGG - Intergenic
987099753 5:14581708-14581730 TCCCCTGCCCGGCCTCTGATTGG + Intergenic
996536335 5:124581622-124581644 TCCACAGCTGGGCCTCTGCACGG + Intergenic
996940913 5:129004329-129004351 TCCCTAGCTCTGACTCTGTCTGG + Intronic
999251825 5:150187100-150187122 TCCCCAGCTCTGCATCCCTCTGG - Intergenic
1001435760 5:171698108-171698130 TCCCCAGCTCCTCCTCCTTCAGG - Intergenic
1002533514 5:179863558-179863580 TCACCAGCACGGACTCCGTCAGG + Exonic
1006396292 6:33789433-33789455 ACCCTAGCTCTGCCTCTGGCAGG + Intergenic
1006399012 6:33805185-33805207 ACCCCACCTCAGCCTCTGCCTGG - Intergenic
1006514112 6:34536571-34536593 TCCCCAGCTGGGCCTGGGCCTGG - Intergenic
1006770255 6:36547196-36547218 TCCCCAGCCCTGCCTCTCCCTGG - Exonic
1007342515 6:41200638-41200660 TTCTCTGCTTGGCCTCTGTCAGG - Intronic
1007363019 6:41372122-41372144 TCCCTCGCTCTGCCTCTCTCGGG + Intergenic
1007743056 6:44024424-44024446 TCCCCAGCTCTAGCTCTCTCAGG - Intergenic
1008109522 6:47477776-47477798 GCACCTTCTCGGCCTCTGTCTGG + Exonic
1015842725 6:137491114-137491136 TACCCAGTACTGCCTCTGTCAGG - Intergenic
1016731399 6:147431999-147432021 TCCCCAGCGCTGCCTGTGCCAGG + Intergenic
1018889088 6:167968830-167968852 GGCCCAGCTCTGCCTCTGACTGG - Intronic
1019138418 6:169927153-169927175 TCCTCAGCCCGGCCCCTGCCAGG - Intergenic
1019621768 7:1995989-1996011 TGCCCAGCCCGGAATCTGTCTGG - Intronic
1020278193 7:6637195-6637217 TGCCCAGCTGGGCCTCGGGCCGG - Intergenic
1021036933 7:15810662-15810684 TCCTCAGCTCCACCTCAGTCTGG + Intergenic
1022895986 7:34750916-34750938 CCCCCAGCTCGGGGTCTGACAGG + Intronic
1031503392 7:122550104-122550126 TGCCCAGCTGGCCCTCTCTCTGG + Intronic
1032267967 7:130381623-130381645 TCCCCAGCTGGACTTCTGGCGGG + Exonic
1032535643 7:132661245-132661267 TCCCTAGCTTGGCCTCTTTGTGG - Intronic
1035224729 7:157426884-157426906 GCCCCAGCTCGGCTTCTGGCGGG - Intergenic
1036206896 8:6812088-6812110 TCCCCAGCCCAGCCTCTGGGGGG + Exonic
1036931262 8:12958462-12958484 TGCCCAGCTATGCCTCTGTAGGG + Intronic
1037317313 8:17611130-17611152 TTCCCAGCTCTGCCTCTAGCTGG + Intronic
1037810126 8:22081954-22081976 GCCCCAGCTCAGCCTCCGGCAGG + Exonic
1039441948 8:37601296-37601318 TCCCCACCCCGACCTCTGCCTGG - Intergenic
1040636137 8:49275057-49275079 TGCCTAGCTCTGCCTCTCTCAGG - Intergenic
1042484181 8:69333427-69333449 TCTCCAGCTCGACCTCTGCCTGG - Intergenic
1042635392 8:70868251-70868273 TCCCCAGTTGGGACTCTGTGTGG + Intergenic
1045649412 8:104328398-104328420 TCCCCAGCTCTGGCCCTGCCTGG + Intergenic
1048496382 8:134939533-134939555 TCCCCAGCCCCACCTCTGCCTGG + Intergenic
1052916095 9:33925273-33925295 TTCCCAGCTCTGCCTCTTCCGGG - Intronic
1052988397 9:34504144-34504166 TCCCCAGCCCAGCCTCTGTCTGG + Intronic
1053560315 9:39185911-39185933 TCCCCACCACAGCCTCTGTTAGG - Intronic
1054136803 9:61433044-61433066 TCCCCACCACAGCCTCTGTTAGG + Intergenic
1057283136 9:93726979-93727001 TCCCCAGCTCGGCCCTTCCCTGG - Intergenic
1057719966 9:97524251-97524273 TCCTCAGCTCTTCCTCTGTTAGG - Exonic
1059395095 9:114029108-114029130 GTCCCAGCTCTGCCTCTGGCTGG + Intronic
1061246219 9:129402399-129402421 TCCCCAGCTCGGGCCTTGGCTGG + Intergenic
1061389897 9:130311665-130311687 TCCCCAGCTCGTCATCTTTCTGG - Intronic
1061481444 9:130899298-130899320 CCCTGTGCTCGGCCTCTGTCTGG - Intergenic
1061713648 9:132504977-132504999 TCCCCAACACCTCCTCTGTCGGG - Intronic
1061727961 9:132591420-132591442 TCCCCAGCTCTGGCTCTGGTGGG + Intergenic
1062003872 9:134229801-134229823 TTCCCAGCTGGGCCTCTGACTGG + Intergenic
1062371379 9:136240901-136240923 CCCTCAGCCCGTCCTCTGTCAGG + Intronic
1062375300 9:136259315-136259337 TCCCCAGCACCGCCTGTTTCAGG - Intergenic
1062681606 9:137785012-137785034 ACTCCAGCTCTGCCTGTGTCTGG - Intronic
1185505190 X:627940-627962 TCCCCATCTCTGCCTCTGCTGGG - Intronic
1187272587 X:17792469-17792491 TCCCAAGCTTGGCCACTGTCAGG - Intergenic
1188261515 X:28030421-28030443 TCCCCAGCCCATCCTCTGTCTGG - Intergenic
1192130602 X:68546060-68546082 TCCCTGGCTCTGTCTCTGTCTGG + Intergenic
1195090818 X:101457477-101457499 TGCCCACCTCTGCCTCTGTTGGG - Intronic
1197324413 X:125074447-125074469 TCCCCAGCTCAGCCTCTAAATGG + Intergenic
1199859635 X:151789717-151789739 TCCCCTAATCAGCCTCTGTCTGG - Intergenic
1200064789 X:153499194-153499216 TCCCCTGCTCTGCCTCTGAGAGG + Intronic