ID: 1173751706

View in Genome Browser
Species Human (GRCh38)
Location 20:45481552-45481574
Sequence CTGACTTGGGTTGAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 441}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173751695_1173751706 24 Left 1173751695 20:45481505-45481527 CCAACCAATAAAGTAACCACTTT 0: 1
1: 1
2: 0
3: 19
4: 187
Right 1173751706 20:45481552-45481574 CTGACTTGGGTTGAGGTGGGTGG 0: 1
1: 0
2: 3
3: 37
4: 441
1173751696_1173751706 20 Left 1173751696 20:45481509-45481531 CCAATAAAGTAACCACTTTCAGC 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1173751706 20:45481552-45481574 CTGACTTGGGTTGAGGTGGGTGG 0: 1
1: 0
2: 3
3: 37
4: 441
1173751694_1173751706 25 Left 1173751694 20:45481504-45481526 CCCAACCAATAAAGTAACCACTT 0: 1
1: 0
2: 1
3: 17
4: 160
Right 1173751706 20:45481552-45481574 CTGACTTGGGTTGAGGTGGGTGG 0: 1
1: 0
2: 3
3: 37
4: 441
1173751697_1173751706 8 Left 1173751697 20:45481521-45481543 CCACTTTCAGCACGTTCTGTCTC 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1173751706 20:45481552-45481574 CTGACTTGGGTTGAGGTGGGTGG 0: 1
1: 0
2: 3
3: 37
4: 441
1173751693_1173751706 30 Left 1173751693 20:45481499-45481521 CCTTTCCCAACCAATAAAGTAAC 0: 1
1: 0
2: 0
3: 7
4: 190
Right 1173751706 20:45481552-45481574 CTGACTTGGGTTGAGGTGGGTGG 0: 1
1: 0
2: 3
3: 37
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173751706 Original CRISPR CTGACTTGGGTTGAGGTGGG TGG Intergenic
901516353 1:9749409-9749431 CTGGCTTTGGTGAAGGTGGGAGG - Intronic
901889016 1:12246070-12246092 CTGACTTGTGTGGAGGTAGCTGG + Intronic
902201483 1:14836677-14836699 TTGGCTTGGGTGGAGGTGGCTGG - Intronic
902251502 1:15156523-15156545 CTGACTTGGGATGTGGTATGGGG + Intronic
902276631 1:15344786-15344808 CTGTGTTGGGTTGATGTGAGGGG - Intronic
902725105 1:18330308-18330330 CTGCCTTGGTTGGAAGTGGGGGG + Intronic
903801532 1:25972339-25972361 CTTTGGTGGGTTGAGGTGGGAGG - Intronic
904456959 1:30653700-30653722 GTGACTTGGGGTGAGGTAGAGGG - Intergenic
904951079 1:34239329-34239351 CTGTCATGGGTTGAGGTTTGAGG - Intergenic
905181638 1:36171026-36171048 CTGACATTGGTGGTGGTGGGGGG - Exonic
905883239 1:41477975-41477997 CTAGCTGGGGTGGAGGTGGGTGG - Intergenic
906179144 1:43803294-43803316 GTTACTCGGGCTGAGGTGGGAGG + Intronic
906513462 1:46424433-46424455 CTGAATGGGGTGGAGGTAGGAGG - Intergenic
907050564 1:51327180-51327202 CTGACTGGGATGGAGGTAGGAGG - Intronic
907427803 1:54391883-54391905 CTGTCTGTGATTGAGGTGGGTGG - Intronic
908672515 1:66563700-66563722 ATTACTTGGGTGGAGGGGGGTGG - Intronic
910892057 1:92028836-92028858 CTGTCTTGGGGTGAGGGGGAGGG - Intergenic
910985209 1:92998532-92998554 CTGATTTGCTTTGTGGTGGGAGG + Intergenic
912652013 1:111448642-111448664 CTCACTTGGGTTGGGGAGAGAGG - Exonic
913267959 1:117063398-117063420 CTGACAGGGGTGGAGATGGGAGG - Intronic
915117338 1:153609102-153609124 TTGCCTGGGGTTGATGTGGGGGG - Intronic
915310490 1:155003840-155003862 CTTACTTGGGATGGGGTGGGAGG - Intronic
915417441 1:155752829-155752851 AAGAGTTGGGTGGAGGTGGGGGG + Intronic
916058104 1:161081802-161081824 CTGCCTGGGGTGGGGGTGGGAGG - Intronic
916078410 1:161216885-161216907 CTGCCGTGGGATGAGGAGGGAGG + Intronic
916840086 1:168591220-168591242 CTGCCTGGGGTTGAGATGGTTGG + Intergenic
916856426 1:168754995-168755017 CTGAGATGGGATGTGGTGGGAGG + Intergenic
917020493 1:170581276-170581298 CTCAGTTGGGCTGAGCTGGGGGG + Intergenic
918199167 1:182251038-182251060 GTGACTGGGGATGAGGTGGGAGG - Intergenic
919207674 1:194437793-194437815 ATAACTGGGGTGGAGGTGGGGGG - Intergenic
920649083 1:207823445-207823467 CTGACCAGGGTAGAGGTGAGAGG - Intergenic
921319313 1:213922985-213923007 CTGACTTGTGGTGGGGTGGGGGG - Intergenic
921630267 1:217424429-217424451 CTGCTTTGGGCTGGGGTGGGAGG - Intergenic
922800219 1:228361696-228361718 CTGCCTTGGAGTGAGGAGGGTGG + Intronic
923035986 1:230285450-230285472 ATGACATGGGAGGAGGTGGGAGG - Intergenic
923181214 1:231521741-231521763 CTGGCTGGGGTGGAGGTGGAGGG - Intergenic
923454994 1:234156943-234156965 TTGCCTAGGGTTGAGGAGGGTGG + Intronic
924239709 1:242029575-242029597 CTGACGGAGGCTGAGGTGGGAGG - Intergenic
924617299 1:245622804-245622826 CTGCCTGGGATTGAGGCGGGGGG + Intronic
1063453439 10:6166640-6166662 CCGACTTGCGGTGAGATGGGAGG - Intronic
1063476499 10:6333263-6333285 CTGCCTTGGGCTGGGGTGGAGGG + Intergenic
1063618826 10:7626185-7626207 CTGCCTTGGCTTGCTGTGGGAGG - Intronic
1063931954 10:11037420-11037442 CTGATTGGGGTGGAGGTAGGGGG + Intronic
1064241757 10:13636308-13636330 GCTACTTGGGTTGAGGTGGAAGG + Intronic
1064450522 10:15438329-15438351 CAGACTTGGGCTGAGGTGGGAGG + Intergenic
1065575367 10:27112808-27112830 GCTACTTGGGCTGAGGTGGGAGG - Intronic
1067010978 10:42713457-42713479 CTGTCGTGGGGTGGGGTGGGGGG + Intergenic
1068395039 10:56449373-56449395 CAGATTTGGCTTGAGGAGGGTGG - Intergenic
1069913001 10:71771241-71771263 CTGACTCAGGGTGAGATGGGTGG - Intronic
1071831931 10:89380543-89380565 GCGACTTGGGCTGACGTGGGAGG - Intronic
1072780867 10:98250760-98250782 CTGACATGGCTTGAGGTGACAGG + Intronic
1073105408 10:101029951-101029973 CTGGCCTGGGTTGGGGAGGGTGG - Intronic
1073218963 10:101853685-101853707 CTACCTTGGGCTGAGGTGGTTGG - Intronic
1074530727 10:114297153-114297175 TGGACATGGGTTGGGGTGGGTGG - Intronic
1075065283 10:119285214-119285236 CAGACTTTGGTGGAGGTAGGGGG + Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075439526 10:122468500-122468522 CTCCCTGGGGATGAGGTGGGTGG + Intronic
1076196086 10:128519342-128519364 CTCTCTTTGGCTGAGGTGGGTGG - Intergenic
1076214400 10:128681152-128681174 CTGGGTGGGGTTGAGGGGGGTGG + Intergenic
1076350217 10:129810441-129810463 CTGACTTGTTTTGAGGAAGGAGG + Intergenic
1076461359 10:130649590-130649612 AAAGCTTGGGTTGAGGTGGGGGG - Intergenic
1076733252 10:132448565-132448587 CAGGGTTGGGGTGAGGTGGGCGG - Exonic
1076779622 10:132717042-132717064 CAGAGTTGTGTTGCGGTGGGCGG - Intronic
1077069219 11:660374-660396 CTGACCTGGGATGAGGTGTGTGG - Intronic
1077142342 11:1030117-1030139 GTGACCTGGGTCGGGGTGGGTGG + Intronic
1077751453 11:4974948-4974970 CTGTCAGGGGTTGAGGTGGGGGG + Intronic
1078138506 11:8672728-8672750 CTGAGGTGGGATGAGGTGGGAGG - Intergenic
1078290525 11:10006160-10006182 CTGACTTGCCTCGAGGTGGACGG - Intronic
1078591184 11:12641513-12641535 ATGAATAGGGTTGGGGTGGGTGG - Intergenic
1079922512 11:26450224-26450246 CTGACTTGGGTGGATGGGTGAGG + Intronic
1080321614 11:31016540-31016562 ATGACTTGGGTTGCGGTGGGTGG + Intronic
1080823120 11:35825856-35825878 CTGAGAGGGGTGGAGGTGGGTGG - Intergenic
1081383176 11:42441400-42441422 CTGGCTTGGGGTGAGGTTGATGG - Intergenic
1082011421 11:47452374-47452396 CTTGCGAGGGTTGAGGTGGGAGG - Intergenic
1082993856 11:59233459-59233481 CTCCCTTGGCTTGGGGTGGGAGG - Intergenic
1083662182 11:64256548-64256570 CTGGCTGGGGTGCAGGTGGGTGG + Intronic
1083755874 11:64791488-64791510 GCTACTTGGGCTGAGGTGGGAGG - Intronic
1084512363 11:69614213-69614235 CTTGCTGGGGTGGAGGTGGGAGG - Intergenic
1085580891 11:77649523-77649545 CTACTTGGGGTTGAGGTGGGAGG - Intergenic
1085646442 11:78226592-78226614 CTGACTTGGCTTGGGGGGGCGGG + Exonic
1086417715 11:86605917-86605939 GGGACTTGGGGTGAGGTTGGGGG - Intronic
1086958082 11:92954380-92954402 GGGACTTGGTTGGAGGTGGGTGG - Intergenic
1087657004 11:100936457-100936479 CTCACTTTGGTTGTGGTGGGGGG - Intronic
1088922504 11:114271376-114271398 ATCACTGGGGTTGGGGTGGGTGG - Intronic
1089678469 11:120106293-120106315 CTGCCATGGGCTGAGGGGGGCGG - Intergenic
1089838694 11:121394677-121394699 GTCATTTGGGTTAAGGTGGGAGG + Intergenic
1090355829 11:126139807-126139829 CTGCCTGGGGTTGAGCTGGGGGG - Intergenic
1090635913 11:128690441-128690463 CAGACTGGGTTTGGGGTGGGCGG - Intronic
1090879885 11:130824173-130824195 CTTACCTGGGGTGAGGTTGGGGG + Intergenic
1091438070 12:489157-489179 CTGTCAGGGGTTGGGGTGGGGGG + Intronic
1091566770 12:1654534-1654556 CTGGCCGGGGGTGAGGTGGGAGG + Intergenic
1091771038 12:3151521-3151543 CTGCCTTGAGGGGAGGTGGGAGG - Intronic
1091993514 12:4975084-4975106 CTGAGTGGAGTTGAGTTGGGCGG + Intergenic
1092128741 12:6093675-6093697 CTGACTTGGGCTGAGGAGGTAGG - Intronic
1092190089 12:6512879-6512901 CAGACTGGGTGTGAGGTGGGAGG + Intronic
1092402790 12:8191299-8191321 CTGTCTTGGGGTGAGTGGGGAGG - Intergenic
1092803017 12:12189850-12189872 CTAACTTGGCTTGTGGCGGGAGG - Intronic
1094430057 12:30358484-30358506 CTGAATCGTGTTGAAGTGGGTGG + Intergenic
1096051135 12:48609103-48609125 CTGTCAGGGGGTGAGGTGGGGGG - Intergenic
1096463855 12:51837445-51837467 CTGCCTTGGGATGGGCTGGGGGG + Intergenic
1096972344 12:55677705-55677727 CTGTCGTGGGGTGGGGTGGGGGG + Intergenic
1097817485 12:64090726-64090748 GCTACTTGGGCTGAGGTGGGAGG + Intronic
1098010015 12:66040946-66040968 CTGAGTTCAGTGGAGGTGGGGGG + Intergenic
1098557723 12:71838445-71838467 TTGAGTTTGGTTGAGGTAGGTGG - Intergenic
1099390392 12:82071956-82071978 CTGCCTTGGTTTGGGCTGGGTGG - Intergenic
1100291031 12:93215092-93215114 CAGACTTGGGCTGTTGTGGGAGG - Intergenic
1100486491 12:95033024-95033046 CTCAGGAGGGTTGAGGTGGGAGG + Intronic
1101219159 12:102618568-102618590 GGGACTAGGGTTGAGGGGGGAGG - Intergenic
1101728870 12:107410340-107410362 CTGAAGTGGGTTGTGGTAGGAGG + Intronic
1102985787 12:117277483-117277505 CTTGCAGGGGTTGAGGTGGGAGG + Intronic
1103266426 12:119634362-119634384 ATACCTTGGGCTGAGGTGGGAGG + Intronic
1103575886 12:121876848-121876870 CTGAAGTGGGCTGAAGTGGGAGG + Intergenic
1103834027 12:123804705-123804727 CTGCTTTGGGCTGAGGTTGGAGG + Intronic
1106330076 13:28732076-28732098 CTGAGGTGGGTTGGAGTGGGCGG + Intergenic
1106449237 13:29864739-29864761 CTGAGATTGGTTGAGGTGTGGGG - Intergenic
1107814850 13:44235242-44235264 CTGACTTGACATGAGGTGGTGGG + Intergenic
1107885668 13:44872492-44872514 CTGCCCTGGGTTGGGGTGTGGGG - Intergenic
1108001490 13:45909367-45909389 CTGAGTTGGGCAGAGCTGGGTGG + Intergenic
1112201207 13:97277168-97277190 CTGAGTTGGGTGGAGTTAGGAGG + Intronic
1112388072 13:98958387-98958409 CTGCCTTGGGTGGGGGTGAGAGG + Intronic
1113649685 13:112026825-112026847 CGGACTTGATTTGAGGTGAGGGG + Intergenic
1113826424 13:113258114-113258136 ATGCCTGGGGCTGAGGTGGGAGG - Intronic
1113882609 13:113636033-113636055 CTGAGTTGGGTGGCGGTGGCCGG - Exonic
1114704919 14:24715106-24715128 CTGTCTGGGATGGAGGTGGGGGG + Intergenic
1115985735 14:39102723-39102745 TGGACTTGGGTGGAGGTGGGTGG + Intronic
1116502677 14:45639357-45639379 CAGACTGGGGTTGGGGTTGGAGG + Intergenic
1116988111 14:51242666-51242688 GCTACTTGGGCTGAGGTGGGAGG + Intronic
1117578581 14:57127960-57127982 CTGTCGTGGGTTGTGGTGAGAGG - Intergenic
1117920110 14:60720851-60720873 CTGAATTGGTTTGAGGGGAGGGG - Intronic
1118780333 14:69003652-69003674 ATGACTTAGGTTTAGGAGGGTGG - Intergenic
1119242691 14:73074566-73074588 CTGTCTTGTGGGGAGGTGGGGGG + Intronic
1119333000 14:73809479-73809501 GTGTCTTGGGTGGTGGTGGGAGG - Intergenic
1119901870 14:78267585-78267607 GTTACTTAGGTTGAGCTGGGAGG + Intronic
1120984230 14:90319504-90319526 TTGGCTAGGGGTGAGGTGGGCGG - Intronic
1121220049 14:92278212-92278234 CTGACTGGGCTTGGGGTGGGGGG - Intergenic
1121276217 14:92669633-92669655 CTGGGTGGGGGTGAGGTGGGGGG + Intronic
1121299718 14:92860892-92860914 AGTACTTGGGCTGAGGTGGGGGG - Intergenic
1121367590 14:93328670-93328692 GTACCTTGGGTTGAGGCGGGAGG + Intronic
1121571330 14:94948755-94948777 CTGACTTGATTTGGGTTGGGTGG + Intergenic
1121800465 14:96770014-96770036 CTGTCTTGGGTTGGGGGTGGGGG + Intergenic
1122247367 14:100413332-100413354 CTGCCTGGGGCTGAGGTTGGGGG - Intronic
1122785070 14:104159805-104159827 CTGACGTGGGCTGGGGTCGGTGG + Intronic
1122871401 14:104640656-104640678 CTCACTAGGGATGAGGAGGGTGG - Intergenic
1123076639 14:105670647-105670669 CTGAGGGAGGTTGAGGTGGGAGG + Intergenic
1123404267 15:20010851-20010873 CTGCCTGGGGTTGATGTTGGGGG + Intergenic
1124452758 15:29811418-29811440 ATTACTTGGGTGGGGGTGGGGGG + Intronic
1125679939 15:41524175-41524197 TGGACAGGGGTTGAGGTGGGTGG + Exonic
1125743694 15:41984879-41984901 CAGACTTGGGTGGATGTGGTGGG + Intronic
1125861665 15:43005406-43005428 CTGTCTTGGAGGGAGGTGGGGGG + Intronic
1128019805 15:64380792-64380814 CCGGCTAGGGTAGAGGTGGGGGG - Intronic
1128137457 15:65274463-65274485 GCTACTTGGGCTGAGGTGGGAGG + Intronic
1129064122 15:72886794-72886816 GTGGCATGGGCTGAGGTGGGAGG + Intergenic
1129482905 15:75842571-75842593 TTGAAATGGGTTGTGGTGGGGGG + Intergenic
1129585737 15:76862640-76862662 CTAATTTGGGATGTGGTGGGTGG + Intronic
1129619171 15:77128182-77128204 CTGACTTGTGCTGAGATGGCTGG - Intronic
1130634593 15:85605466-85605488 CTGTTGTGGGGTGAGGTGGGAGG + Intronic
1130656641 15:85795871-85795893 CTGACGGAGGTGGAGGTGGGAGG + Intergenic
1131069162 15:89453947-89453969 GCTACTTGGGCTGAGGTGGGAGG + Intergenic
1131651164 15:94401014-94401036 AAAACCTGGGTTGAGGTGGGTGG + Intronic
1131804649 15:96108921-96108943 CGGACTTGGGGTGAGGGGGATGG - Intergenic
1134071658 16:11263904-11263926 CTTACTCGGCTTGGGGTGGGTGG - Intronic
1134588845 16:15435261-15435283 CTTCCTTGGGTCGGGGTGGGAGG + Intronic
1136508241 16:30720290-30720312 CTGGCTTGGGCCGGGGTGGGGGG - Exonic
1137816030 16:51398142-51398164 CTGGCCTGGGTTGAGGTGAGAGG - Intergenic
1138477733 16:57282077-57282099 CTGATTGGGGTTGGGATGGGTGG - Intronic
1138938460 16:61760024-61760046 TTTCCTTGGGTTGGGGTGGGGGG - Intronic
1138957861 16:61992895-61992917 GCTACTTGGGTTGAAGTGGGAGG - Intronic
1138969221 16:62124329-62124351 CTGACAGGGGTTGGGGTGTGGGG + Intergenic
1142053935 16:87979851-87979873 GCTACTTGGGCTGAGGTGGGGGG + Intronic
1142480025 17:213537-213559 GTGTCTTGGGTTGGGCTGGGGGG - Exonic
1143342386 17:6223084-6223106 CTGAGTTGGGGGGAGGGGGGAGG + Intergenic
1144450719 17:15376015-15376037 CTGGGTTGAGTTGCGGTGGGAGG + Intergenic
1144946729 17:18973193-18973215 CTGCATTGGGAGGAGGTGGGAGG - Intronic
1145917986 17:28587607-28587629 CTCAGCTGGATTGAGGTGGGAGG + Intronic
1147171474 17:38621824-38621846 CTGACTAGGGATGATGGGGGTGG - Intergenic
1147473728 17:40689356-40689378 CCAACTTGGGAGGAGGTGGGTGG - Intergenic
1147953511 17:44120017-44120039 CTGTCTTGGCTGGATGTGGGAGG - Intronic
1148029297 17:44608641-44608663 GTGACTGGGGCTGGGGTGGGAGG + Intergenic
1148861963 17:50609224-50609246 CAGACGAGGGTGGAGGTGGGAGG + Intronic
1149884501 17:60327490-60327512 CTGAGGTGGGGTGGGGTGGGCGG - Intronic
1151253246 17:72854295-72854317 TTGACTGGGGATGAAGTGGGGGG + Intronic
1151456348 17:74228383-74228405 CTCATTTGGGTTGGGGTGGGGGG - Intronic
1152433475 17:80261561-80261583 TTGACTTTGGTTGTGGTTGGGGG + Intronic
1156867335 18:41903781-41903803 CTGACTTCTGTTTAGGTGGCTGG - Intergenic
1157518782 18:48330476-48330498 GTGACTTGAGTGGAGGTGAGGGG - Intronic
1157527841 18:48398511-48398533 TTGACTTGGGGTGAGGTGCAGGG - Intronic
1158499671 18:57989220-57989242 TGAACTTGGGGTGAGGTGGGTGG - Intergenic
1158643798 18:59225640-59225662 GGGCCTTGGGTTGAGGTGGCTGG - Exonic
1158862966 18:61611002-61611024 CGTACTGGGGTTGAGGTGTGGGG - Intergenic
1159217405 18:65412454-65412476 GGGACTTGGGTGGAAGTGGGGGG + Intergenic
1159364164 18:67444881-67444903 CTGTCAGGGGTTGGGGTGGGAGG - Intergenic
1159467060 18:68797420-68797442 CTGATGGGGGTTGAGGGGGGAGG - Intronic
1160275776 18:77433662-77433684 CTGACGTGGGGTGAGGGGGAGGG - Intergenic
1161501897 19:4620795-4620817 CAGACTTGGGGTGAGGCGGCTGG + Intergenic
1162303885 19:9859804-9859826 CTTACTGGGATTGGGGTGGGGGG - Intronic
1163634710 19:18432626-18432648 CAGGCTTGGGGTGGGGTGGGAGG + Intronic
1163726566 19:18926378-18926400 GTGAGTGGGGTTGGGGTGGGTGG + Intronic
1163748192 19:19060332-19060354 CTTCCTTGGGCTAAGGTGGGAGG - Intergenic
1165342720 19:35224366-35224388 CTGACTTGGGGAGTGGTGGCTGG + Intergenic
1165388417 19:35525014-35525036 GTGACTGGGGCTGCGGTGGGAGG + Intronic
1165736645 19:38181084-38181106 CTGAGCTGGGAAGAGGTGGGGGG + Intronic
1166455322 19:42935724-42935746 GTGACTTGGGCTGTGGTGGGCGG + Exonic
1166804294 19:45475959-45475981 ATGAGATGGGTTGGGGTGGGGGG - Intronic
1166855175 19:45779733-45779755 CTGACTTGACTCGTGGTGGGCGG - Intronic
1166983417 19:46645402-46645424 CTCAGGGGGGTTGAGGTGGGAGG + Intergenic
1167103231 19:47416770-47416792 CTGACTCGGTGTGTGGTGGGTGG + Intronic
1167281606 19:48572543-48572565 CTGACCTGTGTCGAGGTGGAAGG + Intronic
1167657833 19:50777839-50777861 ATGACTTGCGTTGCCGTGGGTGG + Intergenic
1167743294 19:51337462-51337484 CTGACTTGGGATGTGGAGCGCGG - Exonic
1167805146 19:51777681-51777703 AGGACTGGGGCTGAGGTGGGAGG + Intronic
1168147707 19:54429200-54429222 CAGAGGTGGGTGGAGGTGGGGGG + Intronic
1168411352 19:56142053-56142075 CTGACTGGGGTAGAGGTGGCGGG - Intronic
926579040 2:14614740-14614762 GTGACTTAGGCTGAGCTGGGAGG - Intergenic
927862864 2:26570986-26571008 CTGGCTTAGGTGGAGGTTGGAGG + Intronic
928392752 2:30921812-30921834 GTGACTTGTGTTGAGTTGTGTGG + Intronic
928444263 2:31319061-31319083 CTGGCTTGTGCTGTGGTGGGGGG - Intergenic
928454527 2:31407150-31407172 CTCACTAAGTTTGAGGTGGGAGG - Intronic
929582002 2:43087147-43087169 CAGACTTGGGGTGAGGGGGCAGG + Intergenic
929967773 2:46548426-46548448 ATGACTTGCCTGGAGGTGGGAGG - Intronic
930027972 2:47041078-47041100 CTGACTGGGGTGGGGGTGGAGGG - Intronic
931561162 2:63562367-63562389 CTGTCGGGGGTTGTGGTGGGAGG + Intronic
931579897 2:63760986-63761008 CCCACTTGGCTTGGGGTGGGAGG + Intronic
931960106 2:67472997-67473019 GTGTCTTGGGATGAAGTGGGAGG - Intergenic
932152774 2:69387687-69387709 AAGAATTAGGTTGAGGTGGGAGG + Intergenic
934196613 2:89842265-89842287 CTGCCTTGGGTTATGGTGGGTGG + Intergenic
935134707 2:100289858-100289880 TACACTTTGGTTGAGGTGGGAGG + Intronic
935262081 2:101364364-101364386 ACAACTTGGGTTGGGGTGGGAGG - Intronic
937081423 2:119142911-119142933 CTGAGTGGGGCTGAGGTGGGAGG - Intergenic
938413393 2:131084192-131084214 CTGTCTTGGGGTGGGGTGGGGGG - Intronic
938937959 2:136144484-136144506 CTGAGTTGGGCTGAGGGGGCTGG - Intergenic
939093365 2:137804504-137804526 CTGTCATGGGGTGGGGTGGGGGG - Intergenic
939984238 2:148814317-148814339 CTGGGTGGGGTGGAGGTGGGAGG + Intergenic
939994415 2:148906755-148906777 CTCAGTGGGGCTGAGGTGGGAGG + Intronic
940181677 2:150941333-150941355 CAGTCTTAGGTTGAGGAGGGAGG - Intergenic
942087039 2:172453414-172453436 GCTACTTGGGCTGAGGTGGGAGG + Intronic
944122064 2:196251146-196251168 CTCACGGGGGCTGAGGTGGGAGG - Intronic
944515578 2:200509450-200509472 CTGCCTGGGGTTGGGGTAGGAGG - Intronic
944621673 2:201522476-201522498 CAGACTCTGGTTGAAGTGGGAGG + Intronic
944665592 2:201956442-201956464 CTGGTTTGGGTTAAGGTGAGAGG - Intergenic
944883768 2:204042245-204042267 AAGACTTGGGTTGGGGAGGGCGG + Intergenic
946660427 2:221993461-221993483 CTGACTTGGGTTGTGGAGAATGG - Intergenic
947232698 2:227903698-227903720 GTGACTTGGGCTGGGGTGGGAGG - Intronic
947621522 2:231594090-231594112 CTGGCGTGGGGTGAGGTGGCTGG - Exonic
947622761 2:231601298-231601320 CTGAGATGTGTTGTGGTGGGAGG + Intergenic
948188255 2:236038371-236038393 CTGAATTAGGTCGAGGTGGCAGG - Intronic
948382448 2:237560079-237560101 AGGACTTGGGCTGAGGTGAGGGG - Intergenic
948386525 2:237584186-237584208 CTTTCTTGGGTGGGGGTGGGGGG - Intronic
948662678 2:239516661-239516683 CTGAGTTGGGCTGAGGTGCCTGG + Intergenic
1168785743 20:538688-538710 CTGAGCTGGGGTGGGGTGGGAGG + Intronic
1169660431 20:7972914-7972936 TTGACTGGGGAGGAGGTGGGTGG - Intergenic
1170010022 20:11712857-11712879 CTGTCTGGGGATGAAGTGGGAGG - Intergenic
1170850859 20:20003329-20003351 CAGACTTGGGTGAAGGTTGGAGG + Intergenic
1171154211 20:22857407-22857429 TTGTCTGGGGTTGGGGTGGGAGG + Intergenic
1171178568 20:23074437-23074459 CTGCCCTGGGTGGAGGTGGCGGG - Intergenic
1172056286 20:32156713-32156735 CTCAGTGGGGCTGAGGTGGGAGG - Intronic
1172610609 20:36248764-36248786 CTGACTGGGGTTGAGATTTGAGG + Intronic
1173058455 20:39638760-39638782 CTGAGTTGGATGGAGGTGAGGGG + Intergenic
1173157593 20:40627691-40627713 CTGACTTAGGGTGAGCAGGGGGG + Intergenic
1173450144 20:43156666-43156688 CTGACTTGGATGGAGGAGGGAGG + Intronic
1173751706 20:45481552-45481574 CTGACTTGGGTTGAGGTGGGTGG + Intergenic
1175220742 20:57415086-57415108 CTGACTTTGGCTGAGGAAGGTGG - Intergenic
1175687157 20:61039905-61039927 CTGACTTGGGTGGTCGTGGGTGG + Intergenic
1176214382 20:63941346-63941368 CTGCCTGGGGCTGAGCTGGGGGG + Intronic
1176377148 21:6092364-6092386 CTGAGCTGGGATGAGGTCGGAGG + Intergenic
1176386136 21:6139349-6139371 CTCATTTGGGGTGAAGTGGGGGG - Intergenic
1176425208 21:6544384-6544406 CTGTCTTGGATCGAGGTGGTGGG + Intergenic
1177870953 21:26572781-26572803 CTAACGTGGGTTGAGCTGGACGG - Intronic
1177871910 21:26583845-26583867 CAGTCTTGGGTGGAGTTGGGGGG - Intergenic
1179449829 21:41460838-41460860 CTGATTTGGGTGGTGGTGGAAGG - Intergenic
1179700699 21:43152701-43152723 CTGTCTTGGATCGAGGTGGTGGG + Intergenic
1179737337 21:43398903-43398925 CTCATTTGGGGTGAAGTGGGGGG + Intergenic
1179746327 21:43445880-43445902 CTGAGCTGGGATGAGGTCGGAGG - Intergenic
1179959608 21:44760671-44760693 CTGCCTTGGGCTGAGGGGGGAGG + Intergenic
1180599885 22:17008704-17008726 CTGACTTGAGTTGGGGTTTGGGG + Intergenic
1180928769 22:19574483-19574505 CTGACTTGGGTGGATCTGGAGGG + Intergenic
1181012692 22:20051739-20051761 GCTACTTGGGCTGAGGTGGGAGG + Intronic
1183019306 22:35014542-35014564 CTCACTGGGCTTGAGGTGAGAGG - Intergenic
1183109367 22:35637718-35637740 CTGCCTTAGGGTGGGGTGGGAGG - Intronic
1183477199 22:38042270-38042292 CTCAGTTGGGTTGTGGAGGGAGG - Intergenic
1183978998 22:41528755-41528777 GTGACTGTGGTTGTGGTGGGGGG + Exonic
1185219347 22:49621796-49621818 CTGACCTTGGTGGAGGTGGCTGG - Intronic
1185312985 22:50166787-50166809 CTGGGTTGGGTGGGGGTGGGGGG + Intergenic
1185318885 22:50191138-50191160 CTGGCCTGGCTTGGGGTGGGTGG - Intronic
951015529 3:17728142-17728164 CTGACTTTGGTTAGGGTGTGTGG - Intronic
951800429 3:26589789-26589811 CAGTCTTGGGTAGGGGTGGGGGG - Intergenic
951845888 3:27083662-27083684 ATCACTTGGCTTGAGGTGAGAGG + Intergenic
951942520 3:28095420-28095442 CTGTCATGGGGTGAGGGGGGTGG - Intergenic
952040334 3:29253727-29253749 ATGACATGGGTTAAGATGGGTGG + Intergenic
952113383 3:30150600-30150622 CTTACTGGTGATGAGGTGGGAGG + Intergenic
952731546 3:36642035-36642057 CTGACTTTGATTCAGGTGAGTGG + Intergenic
953027048 3:39151517-39151539 CTGGCTTGGGTTGAGGCCTGGGG - Intronic
953284896 3:41597022-41597044 CTCCCTTGGGTTGGGGTTGGTGG + Intronic
953539241 3:43801031-43801053 CTGTCATGGGTTGAGGGGAGAGG - Intergenic
953919559 3:46942695-46942717 CTGCCCTGAGTTGGGGTGGGGGG - Intronic
953968941 3:47332245-47332267 GCTACTTGGGCTGAGGTGGGAGG + Intronic
954405357 3:50342288-50342310 AGCACTGGGGTTGAGGTGGGTGG + Intronic
955206743 3:56902850-56902872 CTGACTTGGGTTGGTGTTTGGGG - Intronic
955651240 3:61196543-61196565 CTGAATTGGGCTGAGGATGGTGG + Intronic
956295509 3:67708952-67708974 ATGACTGGGGTAGAGGTGAGAGG - Intergenic
956846439 3:73187897-73187919 CTGGCTTGAATTGAGGTAGGGGG + Intergenic
959339845 3:105114817-105114839 CTGTCATGTGTTGGGGTGGGAGG + Intergenic
959515420 3:107261173-107261195 CTTGCTGGGGCTGAGGTGGGAGG + Intergenic
959716823 3:109442783-109442805 CTGCCTGGGGTTGAGGGGAGGGG - Intergenic
959868091 3:111294043-111294065 CTGAGAAGGGTTGTGGTGGGAGG - Intronic
960115218 3:113886045-113886067 TCCACTTGGGTTGGGGTGGGGGG + Intronic
960230508 3:115220571-115220593 CTGCTTTGTGTTGGGGTGGGTGG + Intergenic
960630623 3:119726817-119726839 GTGTCTTGGGTCGGGGTGGGGGG - Intronic
960822530 3:121749667-121749689 CTGACGTGGCTTGAATTGGGAGG - Exonic
961475015 3:127140848-127140870 CTCAGTGGGGTTGGGGTGGGTGG + Intergenic
962595893 3:136943029-136943051 CTGACTTGGGGTGTGGGGGATGG + Intronic
963203038 3:142603658-142603680 GTTACTTAGGCTGAGGTGGGAGG + Intronic
963216376 3:142753172-142753194 CTGGCTTGGTTTGAGGTTGGGGG + Intronic
963514152 3:146288044-146288066 CTGTCGTGAGTTGGGGTGGGGGG - Intergenic
964110781 3:153085204-153085226 CTGAGGTGGGAGGAGGTGGGAGG - Intergenic
964576356 3:158173933-158173955 TTGCCTAGGGTTGGGGTGGGGGG + Intronic
964710819 3:159669596-159669618 GTGACCTGGAGTGAGGTGGGAGG - Intronic
965859097 3:173125342-173125364 ATGACTTGGGTTGCTGTGTGAGG - Intronic
967008646 3:185409910-185409932 CAGACTAGGGATGTGGTGGGTGG + Intronic
967180213 3:186896862-186896884 CAGACTTGGGATGTGGTGGGGGG - Intergenic
967205622 3:187118132-187118154 CTGAGCTGAGTTGAGCTGGGTGG - Intergenic
969638981 4:8385632-8385654 CTGACTTGGGTAGGGGAGGCTGG - Intronic
969941327 4:10734859-10734881 GTGAGCTGAGTTGAGGTGGGTGG + Intergenic
970566244 4:17334995-17335017 CTGAATGGGGGTGGGGTGGGTGG - Intergenic
972468946 4:39385290-39385312 GCTACTTGGGCTGAGGTGGGAGG - Intergenic
973018800 4:45173181-45173203 CTGTCTTGGCTAGGGGTGGGGGG + Intergenic
973824514 4:54691734-54691756 ATGAGTTGGGGTGGGGTGGGTGG + Intronic
973896435 4:55418413-55418435 CTCAGGAGGGTTGAGGTGGGAGG + Intronic
975067483 4:70086045-70086067 CTGAAGTGGGTGAAGGTGGGAGG + Intergenic
975726081 4:77293068-77293090 TTAACCTGGGTTGAAGTGGGAGG + Intronic
975874626 4:78821453-78821475 TGGTCTTGAGTTGAGGTGGGGGG + Intronic
976462462 4:85328128-85328150 GTGATGTGGGGTGAGGTGGGAGG + Intergenic
976906302 4:90240454-90240476 GTGATTTGGGTAGAGGTGTGAGG - Intronic
978106706 4:104911571-104911593 CTATCTTGGGTTAAAGTGGGTGG - Intergenic
978685511 4:111438024-111438046 CTGTCATGGGTTGGGGTGGGGGG - Intergenic
980110257 4:128629288-128629310 CTTTGTGGGGTTGAGGTGGGTGG + Intergenic
980847687 4:138343653-138343675 CTCATTAGGGTTGAGGTGAGAGG - Intergenic
982039776 4:151385251-151385273 CAGACTGGGGTGGAGGTGGGGGG + Intergenic
983529301 4:168793478-168793500 GTGATTTGGGGTGAGGTGGGAGG - Intronic
983970711 4:173869530-173869552 CTGGGTTGAGGTGAGGTGGGTGG + Intergenic
984020517 4:174479193-174479215 CTTGCTGGGGCTGAGGTGGGAGG + Intergenic
984144367 4:176043642-176043664 ATCTCTAGGGTTGAGGTGGGGGG + Intergenic
984321469 4:178202470-178202492 CTTCCTGGGGCTGAGGTGGGAGG + Intergenic
984471760 4:180184490-180184512 CTGAATTTGGTTGTGGTGGTGGG + Intergenic
984627991 4:182030230-182030252 CTGTCATGGGGTGGGGTGGGGGG - Intergenic
984731752 4:183075045-183075067 GTGGCTTATGTTGAGGTGGGAGG + Intergenic
985208628 4:187568352-187568374 CTGGCTTGAGTTGATGTGGATGG - Intergenic
987288119 5:16480155-16480177 TTGCCTGGGGATGAGGTGGGTGG - Intronic
987795711 5:22625154-22625176 CTGTCTTGGGTTGTGGGGAGCGG + Intronic
988570561 5:32360918-32360940 CTCAGGTGGCTTGAGGTGGGAGG - Intronic
988708118 5:33745259-33745281 CTGCCTTGGGTGGAGGCAGGAGG - Intronic
988801478 5:34700034-34700056 CAGACTTGTTTTGAGCTGGGTGG + Intronic
990197458 5:53334621-53334643 TAGAGTTGGGTTGAGGTTGGGGG - Intergenic
990996563 5:61737716-61737738 CTGGCTGGCGTTGAGGTGAGTGG + Intronic
991109598 5:62883449-62883471 CTGACATTTTTTGAGGTGGGGGG + Intergenic
992529009 5:77637727-77637749 CTGATTTGGGTTGATTTCGGGGG - Intronic
993106397 5:83605584-83605606 CTGTGTTTGGTTGGGGTGGGTGG + Intergenic
993478016 5:88388815-88388837 ATAACTTGGAATGAGGTGGGAGG + Intergenic
993478854 5:88397693-88397715 CTTAGTTGGGATGAGGGGGGAGG - Intergenic
996398325 5:123035072-123035094 GTGACTTGAGATGAGGTTGGAGG - Intronic
997364261 5:133315621-133315643 CTGAGTTGGGTGGTGGGGGGCGG - Intronic
997393902 5:133541028-133541050 CTGACTTTGGTTTTGGTGGCAGG - Intronic
997651672 5:135526404-135526426 CTGAGGTAGGCTGAGGTGGGAGG + Intergenic
997825810 5:137106121-137106143 CTGGCTCTGGTTGTGGTGGGGGG - Intronic
998084244 5:139303620-139303642 GCTACTTGGGCTGAGGTGGGAGG + Intronic
998217338 5:140247216-140247238 GCTACTTGGGCTGAGGTGGGAGG - Intronic
998579403 5:143355365-143355387 GCCACTTGGGCTGAGGTGGGAGG + Intronic
999870276 5:155742648-155742670 CTTGCTTGGTATGAGGTGGGTGG - Intergenic
1001210634 5:169807153-169807175 CTGAATTGGTCTGGGGTGGGTGG + Intronic
1001557711 5:172647713-172647735 CAGGCCTGGGGTGAGGTGGGCGG - Intronic
1002662884 5:180803183-180803205 CTCCCCTGGGTTGGGGTGGGGGG - Intronic
1002791577 6:441367-441389 CTGAGCAGGGGTGAGGTGGGAGG - Intergenic
1004014837 6:11722892-11722914 CTGAGTTGGGAGGAGGTGGGAGG + Intronic
1004649736 6:17598004-17598026 GTCACTCGGGCTGAGGTGGGAGG + Intergenic
1004982574 6:21042556-21042578 CTGACTTGAGTGGAGGCAGGTGG - Intronic
1005236434 6:23766859-23766881 CTGTCTGAGGCTGAGGTGGGAGG - Intergenic
1005468629 6:26140366-26140388 CTGACTTGGTGGGAGGTGTGTGG - Intergenic
1005834091 6:29694865-29694887 CTGATTTGTATTGAGGTGCGTGG + Intergenic
1005967199 6:30735158-30735180 CTGAGTGGGGTTGAGGGGGTTGG + Intronic
1006166168 6:32066824-32066846 ATCACTTTGGCTGAGGTGGGAGG + Intronic
1007507494 6:42347239-42347261 CTGCCTTTGGGAGAGGTGGGTGG - Intronic
1007714737 6:43849236-43849258 CTGGCATGGGCTGAGGTGGCGGG + Intergenic
1007773783 6:44212160-44212182 GTCACTTGGGCTGAGGCGGGAGG + Intergenic
1008871476 6:56277291-56277313 CTGTCGTGGGTTGAGGGGAGTGG - Intronic
1009686173 6:66960459-66960481 CTGTCGTGGGATGTGGTGGGGGG + Intergenic
1009821650 6:68810319-68810341 CTCATTTGGGTTGGGGTTGGTGG - Intronic
1009825609 6:68862132-68862154 CTGAATTGGGGTGGGGGGGGGGG - Intronic
1009848349 6:69163183-69163205 CTGTCTTGGGCTGATGTGAGAGG - Intronic
1010224138 6:73473893-73473915 CTCAAGGGGGTTGAGGTGGGAGG - Intronic
1010281351 6:74026974-74026996 CTGTCATGGGATGGGGTGGGGGG - Intergenic
1010995032 6:82523363-82523385 CTGACTTGTGTTGTGGGGAGAGG + Intergenic
1012399788 6:98834188-98834210 AAGACTTGGATTGGGGTGGGGGG - Intergenic
1013518406 6:110910585-110910607 CTGTCCTGGGGTGAGATGGGGGG + Intergenic
1014802847 6:125796338-125796360 CTGATTTATATTGAGGTGGGTGG - Intronic
1015025340 6:128525618-128525640 GTGAATTGGATTGAGGTGGAGGG + Intergenic
1016055265 6:139571867-139571889 CGGACTTGGGGTCGGGTGGGGGG - Intergenic
1016318315 6:142814480-142814502 CTGAATTGGGCAGAGGTGGTGGG + Intronic
1017913568 6:158815585-158815607 CTGACTGAGGCTGAAGTGGGAGG - Intronic
1019346218 7:531999-532021 CTGACGGGCGTTGGGGTGGGAGG - Intergenic
1019420428 7:948199-948221 CAGACATGGGGTGAGGAGGGAGG - Intronic
1019566846 7:1687116-1687138 CTGAGTTGGGGGGAGGTGCGGGG + Intergenic
1019593462 7:1847385-1847407 GTGACTTGGGAAGATGTGGGGGG + Exonic
1019856092 7:3609703-3609725 CTGTCTTGGGTGGCGGGGGGTGG - Intronic
1021261616 7:18465456-18465478 CTGATTTCTGTGGAGGTGGGTGG + Intronic
1022532675 7:31076733-31076755 CTGCCTTGGGAGTAGGTGGGGGG + Intronic
1022858507 7:34340910-34340932 TTGACTGGTGTTGAGTTGGGAGG - Intergenic
1022968063 7:35492813-35492835 CTGACCTGGGTGGAGGAGAGAGG - Intergenic
1023164685 7:37331882-37331904 CTGTATGGGTTTGAGGTGGGAGG + Intronic
1023215262 7:37855511-37855533 CTAACTTGGGATTTGGTGGGGGG - Intronic
1023289897 7:38657902-38657924 CTCAGTGGGGCTGAGGTGGGAGG - Intergenic
1023472888 7:40544110-40544132 TTGGCTTGGGTGAAGGTGGGAGG + Intronic
1023759838 7:43455053-43455075 CTGAGCTGGGGTGAGGTGGGTGG - Intronic
1024961684 7:54982919-54982941 CTACCTTGGGTTGAGGCAGGGGG - Intergenic
1025839847 7:65136188-65136210 CTGTCTTGGGGTGGGGTGGGGGG - Intergenic
1025883219 7:65559777-65559799 CTGTCTTGGGGTGGGGTGGGGGG + Intergenic
1025890227 7:65642829-65642851 CTGTCTTGGGGTGGGGTGGGGGG - Intergenic
1026569949 7:71520737-71520759 ATTACTAGGCTTGAGGTGGGAGG + Intronic
1028351098 7:89849692-89849714 ATGTCTTGGGTGTAGGTGGGTGG + Intergenic
1029386900 7:100249143-100249165 CTGGCCTGGGGTGGGGTGGGTGG + Intronic
1029627546 7:101729767-101729789 CTGACTGGGGGTGAGGTGGGGGG - Intergenic
1029660924 7:101961009-101961031 CTGGCTTGGGCTGTGGTGGGTGG + Intronic
1030050799 7:105535662-105535684 CTCAGGTGGGCTGAGGTGGGAGG - Intronic
1030093445 7:105877090-105877112 CTGGCTCGGGTGGGGGTGGGGGG - Intronic
1030128374 7:106176716-106176738 CTGTCTTGTGCTGAGCTGGGTGG - Intergenic
1030177423 7:106669269-106669291 GTGACTTGGTTTAAGGTGGAAGG - Intergenic
1031852254 7:126879159-126879181 CTGTCTTGGGGTGGGGTCGGGGG + Intronic
1034397643 7:150839280-150839302 CTGGCTTGGGTTGAGAAGGTTGG - Intronic
1034469257 7:151246915-151246937 ATGCCTGGGGGTGAGGTGGGTGG - Intronic
1035391784 7:158509037-158509059 CTGATGCGGGTGGAGGTGGGTGG + Intronic
1035575559 8:702513-702535 CCGTCTTGGCTGGAGGTGGGAGG - Intronic
1036409805 8:8489007-8489029 CTGGCTGGGGTGGAGGTAGGGGG - Intergenic
1036660481 8:10705185-10705207 CTGGCTGGGGGTGTGGTGGGTGG - Intronic
1036675111 8:10825115-10825137 CTGGGTTTGGTTGAGGTGAGAGG - Intronic
1037286784 8:17310107-17310129 GCTACTTGGGCTGAGGTGGGAGG - Intronic
1037613327 8:20495017-20495039 CTGACTTGGGGTTAGATGGTTGG + Intergenic
1037617940 8:20536558-20536580 CTGCGTTGTGTTGGGGTGGGTGG + Intergenic
1037930005 8:22873521-22873543 CTCAATGGGGCTGAGGTGGGAGG + Intronic
1038407562 8:27333368-27333390 CTGACTTCGGTGGAGGTGCGAGG + Intronic
1038946446 8:32366344-32366366 CTGAGATGGGTGGAGGTGGGGGG - Intronic
1040900978 8:52416875-52416897 CTGCCTTGGGGTCTGGTGGGAGG + Intronic
1041895314 8:62917328-62917350 CTCACCTGGCTTGAGGTGAGAGG + Intronic
1042255437 8:66798249-66798271 CTTTCTGGGGCTGAGGTGGGAGG - Intronic
1044369662 8:91394152-91394174 CTGAGGTGGGGTGGGGTGGGGGG - Intronic
1045364877 8:101466844-101466866 CTGACCCGGGTTGAGGCTGGTGG - Intergenic
1045710014 8:104972351-104972373 CTGACAGTGGTTGAGCTGGGCGG - Intronic
1045967027 8:108036675-108036697 CTTGCTGGGGGTGAGGTGGGAGG + Intronic
1046187127 8:110735250-110735272 CTGGTTTGGGGTGAGGTGGCCGG - Intergenic
1046391073 8:113573767-113573789 CTGTCATGGGGTGAGGTGAGAGG - Intergenic
1047976012 8:130131518-130131540 CTTTCTGGGGTCGAGGTGGGAGG + Intronic
1048036181 8:130679480-130679502 CTGACAGGGGTGGAGGTGGTGGG + Intergenic
1048520569 8:135150465-135150487 CTGTTGTGGGTTGGGGTGGGGGG - Intergenic
1048798238 8:138171365-138171387 CTGCCTTTGGTTGAGCTGAGTGG - Intronic
1049265944 8:141667990-141668012 CTGACTTAGGTTGGAGAGGGTGG + Intergenic
1049348166 8:142149902-142149924 CTGACCTGGGATGAGCTGGAGGG - Intergenic
1049689727 8:143953254-143953276 TTGTCTTGGGGTGGGGTGGGGGG - Intronic
1050419667 9:5450462-5450484 CTGCCTTGGGCAGAGGTGGGCGG + Intergenic
1051193288 9:14536543-14536565 AAGACTTGGGTTGAGGGTGGGGG + Intergenic
1051385196 9:16500218-16500240 CAGACTTGAGTTGAGTTTGGTGG - Intronic
1052978466 9:34429645-34429667 ATGACTAGGGTTGGGGTGGCAGG + Intronic
1052997623 9:34559610-34559632 CTGCCTGGGGGTGGGGTGGGGGG + Intronic
1054833083 9:69647888-69647910 TTGACTGGGGTTTTGGTGGGTGG + Intronic
1055688648 9:78806262-78806284 TTGTCTTGGGCTGAGGTGGTTGG - Intergenic
1056536937 9:87536654-87536676 CTGACATGGGTAGGGGTGGTGGG - Intronic
1057944049 9:99309252-99309274 CTGGCCTGGGGTAAGGTGGGCGG - Intergenic
1058633291 9:107011089-107011111 CTGGCTTGGGCTGAGAAGGGAGG + Exonic
1058739180 9:107925270-107925292 ACTACTTGGGCTGAGGTGGGAGG + Intergenic
1061015157 9:127977204-127977226 CTGAATGGGGCTGAGGAGGGAGG - Intronic
1061761735 9:132856296-132856318 CTGCCCTGGGCAGAGGTGGGAGG - Intronic
1061987244 9:134136634-134136656 CTGCCTCGGGTTGGGGTGAGCGG - Intronic
1062394896 9:136348848-136348870 CAGACAGGGGCTGAGGTGGGTGG - Intronic
1062452716 9:136622271-136622293 GTCACTCGGGATGAGGTGGGGGG - Intergenic
1062612192 9:137380337-137380359 CGGACGGGGGTTGGGGTGGGGGG - Intronic
1186473943 X:9842745-9842767 CTGGCTTGGGGCGAGGCGGGAGG + Intronic
1190154025 X:47973255-47973277 GGGAGTTGGGTGGAGGTGGGAGG - Intronic
1191943498 X:66504426-66504448 CTGCCTAGGGTTGGGATGGGTGG - Intergenic
1192209305 X:69117449-69117471 CTGCCTTGGGTAGATGTGGCAGG + Intergenic
1192722696 X:73716400-73716422 CTGTCTTGGGAGGTGGTGGGGGG - Intergenic
1195715193 X:107811672-107811694 CTAACTTGGCCTGAGGTGAGTGG - Intergenic
1197980104 X:132209057-132209079 CTTACTAGGGTTGGAGTGGGAGG + Intronic
1198578450 X:138036733-138036755 CAGGCTGGGGTTGGGGTGGGGGG - Intergenic
1198828285 X:140721386-140721408 CGGACTGGGGGTGAGGTGGGAGG + Intergenic
1201767262 Y:17583520-17583542 TTGAGGTGGGCTGAGGTGGGCGG - Intergenic
1201834291 Y:18322465-18322487 TTGAGGTGGGCTGAGGTGGGCGG + Intergenic