ID: 1173756766

View in Genome Browser
Species Human (GRCh38)
Location 20:45523306-45523328
Sequence AGACACAACCAGAGGAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173756766_1173756771 16 Left 1173756766 20:45523306-45523328 CCCATCTTCCTCTGGTTGTGTCT No data
Right 1173756771 20:45523345-45523367 TGCCTCAATTTGCTCCTTTCAGG No data
1173756766_1173756769 -8 Left 1173756766 20:45523306-45523328 CCCATCTTCCTCTGGTTGTGTCT No data
Right 1173756769 20:45523321-45523343 TTGTGTCTCCACAGTCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173756766 Original CRISPR AGACACAACCAGAGGAAGAT GGG (reversed) Intergenic
No off target data available for this crispr