ID: 1173756769

View in Genome Browser
Species Human (GRCh38)
Location 20:45523321-45523343
Sequence TTGTGTCTCCACAGTCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173756767_1173756769 -9 Left 1173756767 20:45523307-45523329 CCATCTTCCTCTGGTTGTGTCTC No data
Right 1173756769 20:45523321-45523343 TTGTGTCTCCACAGTCTGCATGG No data
1173756765_1173756769 -7 Left 1173756765 20:45523305-45523327 CCCCATCTTCCTCTGGTTGTGTC No data
Right 1173756769 20:45523321-45523343 TTGTGTCTCCACAGTCTGCATGG No data
1173756766_1173756769 -8 Left 1173756766 20:45523306-45523328 CCCATCTTCCTCTGGTTGTGTCT No data
Right 1173756769 20:45523321-45523343 TTGTGTCTCCACAGTCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173756769 Original CRISPR TTGTGTCTCCACAGTCTGCA TGG Intergenic
No off target data available for this crispr