ID: 1173756771

View in Genome Browser
Species Human (GRCh38)
Location 20:45523345-45523367
Sequence TGCCTCAATTTGCTCCTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173756768_1173756771 8 Left 1173756768 20:45523314-45523336 CCTCTGGTTGTGTCTCCACAGTC No data
Right 1173756771 20:45523345-45523367 TGCCTCAATTTGCTCCTTTCAGG No data
1173756770_1173756771 -7 Left 1173756770 20:45523329-45523351 CCACAGTCTGCATGGATGCCTCA No data
Right 1173756771 20:45523345-45523367 TGCCTCAATTTGCTCCTTTCAGG No data
1173756765_1173756771 17 Left 1173756765 20:45523305-45523327 CCCCATCTTCCTCTGGTTGTGTC No data
Right 1173756771 20:45523345-45523367 TGCCTCAATTTGCTCCTTTCAGG No data
1173756767_1173756771 15 Left 1173756767 20:45523307-45523329 CCATCTTCCTCTGGTTGTGTCTC No data
Right 1173756771 20:45523345-45523367 TGCCTCAATTTGCTCCTTTCAGG No data
1173756766_1173756771 16 Left 1173756766 20:45523306-45523328 CCCATCTTCCTCTGGTTGTGTCT No data
Right 1173756771 20:45523345-45523367 TGCCTCAATTTGCTCCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173756771 Original CRISPR TGCCTCAATTTGCTCCTTTC AGG Intergenic
No off target data available for this crispr