ID: 1173757964

View in Genome Browser
Species Human (GRCh38)
Location 20:45534898-45534920
Sequence GCTTCCGTCTGACCTGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173757958_1173757964 1 Left 1173757958 20:45534874-45534896 CCAGGGCTGGGCTGGGTTTACCG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1173757964 20:45534898-45534920 GCTTCCGTCTGACCTGGTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 98
1173757957_1173757964 2 Left 1173757957 20:45534873-45534895 CCCAGGGCTGGGCTGGGTTTACC 0: 1
1: 0
2: 1
3: 25
4: 276
Right 1173757964 20:45534898-45534920 GCTTCCGTCTGACCTGGTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173757964 Original CRISPR GCTTCCGTCTGACCTGGTCT GGG Intronic
900185746 1:1332440-1332462 GCTGACCTCTGACCTGGTCATGG + Exonic
900300627 1:1975035-1975057 GCCTGCGTCTGACCTTGTCCAGG - Intronic
901221701 1:7587139-7587161 TCTTCCCTCTCACCTGGTCTGGG - Intronic
907750304 1:57256931-57256953 GCTTCAGTCAGACTAGGTCTAGG - Intronic
915314922 1:155023104-155023126 GCTTCCTGCTCACCTGGACTCGG + Exonic
921326456 1:213989478-213989500 GCTTCGGTCTGGTCTCGTCTGGG + Intronic
922614624 1:226954489-226954511 GGTTCCGTCTCAGCAGGTCTGGG - Intronic
922883978 1:229003898-229003920 GCTGCCATCTGACGTGGTGTTGG - Intergenic
924719527 1:246609143-246609165 ACTTCCTTCTGACCTGACCTCGG - Intronic
1069990133 10:72310113-72310135 TCTTCCCTCCGACCTGGGCTGGG + Intergenic
1073253173 10:102134043-102134065 GCTTCCGTCTGACCGGCTTGGGG + Intronic
1075260946 10:120963484-120963506 GCAGCCTTCTGACCTGGGCTGGG - Intergenic
1076474642 10:130743711-130743733 GCTTCCTTCTGAGCTTTTCTGGG - Intergenic
1081750217 11:45505314-45505336 GCTTCCTTCTTCCCTTGTCTTGG + Intergenic
1090385416 11:126355488-126355510 GCTTGCCTCTGTCCGGGTCTCGG + Intergenic
1092211111 12:6647063-6647085 GGGTCTGTCTGTCCTGGTCTCGG - Intronic
1100043213 12:90345556-90345578 GCATCACTCTGACCTGGTCATGG + Intergenic
1102645020 12:114398164-114398186 GCCCCCGGCTCACCTGGTCTGGG - Intronic
1108495011 13:51016818-51016840 GCCTCTGTCTGCACTGGTCTGGG - Intergenic
1112228865 13:97568068-97568090 GCTTCCCTGTGGGCTGGTCTGGG - Intergenic
1115221617 14:31063653-31063675 GCTTTAGTCTGTTCTGGTCTGGG - Intronic
1115993128 14:39170128-39170150 GCTCCCGTTTGAGCTGGTCTGGG + Exonic
1116763346 14:49041273-49041295 GCTTCCCTCTGTCCATGTCTCGG + Intergenic
1117290407 14:54326674-54326696 TCTTCCCTCTGACATGGTCAAGG + Intergenic
1121597078 14:95172166-95172188 GCTTCCACCTTACCTGGTCAAGG + Intergenic
1121862861 14:97336005-97336027 GCATCCTTCTGTCCTGGTCCTGG - Intergenic
1122951945 14:105050078-105050100 GCATCAGTGTGACCTGGTCTAGG + Exonic
1126775286 15:52095008-52095030 GCTGACCTCTGACCTAGTCTAGG + Intergenic
1128776940 15:70327877-70327899 GCTTCTGACTGGCCTGGCCTCGG + Intergenic
1129118309 15:73378902-73378924 ACTTCTGTCTGACCCAGTCTGGG + Intergenic
1129443879 15:75602571-75602593 GATTCTGACTGAACTGGTCTGGG + Intronic
1130401291 15:83556948-83556970 GCTTCCACCTGACCAAGTCTGGG - Intronic
1131374622 15:91913424-91913446 GGTTCTGACTGAACTGGTCTGGG - Intronic
1132750640 16:1455881-1455903 GCTTCTTTCTGACGTGGTCTGGG - Intronic
1133229765 16:4360930-4360952 GCAGCCGTCCTACCTGGTCTTGG + Exonic
1135968589 16:27055689-27055711 GCTTCTCTCTGAGCTGGGCTGGG - Intergenic
1135969713 16:27063476-27063498 TCTTCCGCCTCACCTGCTCTGGG - Intergenic
1137734974 16:50717026-50717048 GAGTCAGTCTGATCTGGTCTTGG + Intronic
1138680137 16:58678300-58678322 GCTTCTGTCTGACCCAGGCTGGG + Intronic
1145126246 17:20302309-20302331 GCTTCAGTCTGCCCTGGTCGGGG - Intronic
1147154290 17:38535776-38535798 GCTTCCCTCTCACCTGGCTTTGG - Intronic
1149918088 17:60630475-60630497 GCTTCCCTCTGTCCCGGCCTAGG + Intronic
1162672260 19:12266905-12266927 GTTCCAGTGTGACCTGGTCTAGG - Intronic
1164615306 19:29664019-29664041 GCTCCCCTCTCACCTGGTCCTGG + Intergenic
1164694919 19:30236184-30236206 GCTTGCTTCTGTGCTGGTCTTGG + Intronic
1165893607 19:39128916-39128938 GCTTCCAACTTACTTGGTCTGGG + Intronic
1166332998 19:42089498-42089520 GCTTCCATCTGCCCTGGCCGAGG + Intronic
1167757307 19:51421038-51421060 GCTTCCCTGTGACCTAATCTGGG + Intergenic
925675465 2:6357134-6357156 GTTTCCCTCAGACCTGGTTTAGG - Intergenic
927056021 2:19366162-19366184 GCTTCTGTTTGACCTGTTTTTGG - Intergenic
929002296 2:37359603-37359625 GCTTCAGGCTGACTGGGTCTTGG + Exonic
934984528 2:98874694-98874716 GGTTCCTTCTGTTCTGGTCTTGG + Intronic
935678339 2:105615506-105615528 ACTTCCGTCTGACCTTGTCTAGG + Intergenic
946248414 2:218399795-218399817 GCTTCGGCGTGACCTGGACTCGG - Exonic
947808319 2:232983377-232983399 TCTGCCTTCTGCCCTGGTCTTGG - Intronic
948551998 2:238778924-238778946 GCTTTGGCCTGAGCTGGTCTTGG - Intergenic
1170355504 20:15488068-15488090 CCTTCAGTCTGTCCTAGTCTAGG + Intronic
1170570556 20:17629901-17629923 GCTCCCGGCTGACCTCGTCCAGG + Exonic
1171859044 20:30377544-30377566 GCTTCGCTCTGACCCTGTCTGGG + Intronic
1172774323 20:37398278-37398300 GCTTAGGTCTGGCATGGTCTGGG + Intronic
1173757964 20:45534898-45534920 GCTTCCGTCTGACCTGGTCTGGG + Intronic
1173901060 20:46589083-46589105 GCTTCCTCCTGGCCTGGCCTTGG - Intronic
1174244994 20:49172331-49172353 GCTTCCGTCTCTCCTTCTCTAGG + Intronic
1179416065 21:41199561-41199583 GCTTCCTTCTGTCCTGTGCTAGG + Intronic
1183249902 22:36723026-36723048 GCCTCCAGCTGTCCTGGTCTGGG + Intergenic
950412396 3:12847600-12847622 CCTTCAGGCTGACCTGGGCTTGG + Intronic
956902395 3:73730294-73730316 GCTTGCCTCCGTCCTGGTCTTGG + Intergenic
963794539 3:149618384-149618406 GCATCCATCTGTGCTGGTCTTGG + Intronic
966868915 3:184277435-184277457 GCTTCAGTATGGCCTGGTTTTGG - Exonic
970826439 4:20281545-20281567 GCTTCTCTCTGACTTGGTGTGGG + Intronic
971165557 4:24179377-24179399 CCTTGCATCTGACCTGGCCTTGG + Intergenic
972726151 4:41747615-41747637 GCTGCCGTATGACCTGACCTTGG - Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
985241390 4:187934188-187934210 GCTTCCGTCTTTCCTGTTTTTGG - Intergenic
986895839 5:12367109-12367131 GATTTCATCTGACCTGGTCTTGG - Intergenic
993710777 5:91222568-91222590 GCTTCCGTTTAACCTGGTTTTGG - Intergenic
998132338 5:139657733-139657755 GCTGCCGGCTGGCCTGGGCTGGG + Intronic
1002054285 5:176589797-176589819 GCTTCCCTCTGCCCTTGGCTGGG - Intronic
1004353682 6:14912829-14912851 GCTTCCTACAGACTTGGTCTTGG - Intergenic
1005401887 6:25443122-25443144 ACTTCTGTCTGACCTCATCTAGG - Intronic
1007395479 6:41575493-41575515 GCTCTCATCTGGCCTGGTCTTGG + Intronic
1013369189 6:109455342-109455364 GATTCCGTCTGCCCTCGTCCGGG - Intronic
1014253254 6:119136765-119136787 GCTACTGTCTGGCCTGGTTTGGG + Intronic
1015793799 6:136990167-136990189 GCTTCCCTCTGCTCTGCTCTCGG - Intergenic
1016272139 6:142301790-142301812 GACTCCGGCTGCCCTGGTCTGGG - Intergenic
1018650655 6:165988875-165988897 GCTACCGTCCGTGCTGGTCTCGG - Intergenic
1022225526 7:28358690-28358712 CCTTACATTTGACCTGGTCTTGG + Intronic
1027223779 7:76231506-76231528 TCTTCCCTCTGACCTGGGCAAGG - Intronic
1028875910 7:95823240-95823262 GATTCCATTTGACCTGGTCTTGG - Intronic
1028875976 7:95823895-95823917 TATTCCATTTGACCTGGTCTTGG - Intronic
1034095047 7:148400006-148400028 GCTTCTGCCTGAGTTGGTCTCGG - Intronic
1035645204 8:1213815-1213837 GCTGCCTCCTGACCTGGTCTGGG + Intergenic
1036510146 8:9392523-9392545 GCTTCTGCCTGAGGTGGTCTGGG - Intergenic
1045168152 8:99630415-99630437 GCTTCTTTCTGTCCTGGTTTAGG + Intronic
1048100529 8:131346140-131346162 GCCTCTCTATGACCTGGTCTAGG - Intergenic
1048471998 8:134712458-134712480 GCTTCCTTCTTGCCTGGCCTCGG - Intronic
1049204830 8:141358881-141358903 GCTCCCGTCTGGCCTGGGCAGGG + Intronic
1049521136 8:143092065-143092087 CCTTCCCTCAGACCTGGGCTGGG - Intergenic
1049813949 8:144589412-144589434 GCTTCCCGCTGCCCTGCTCTGGG - Intronic
1050913969 9:11108166-11108188 GCTTCCCTCTGACCTGGGATAGG - Intergenic
1053725283 9:40992598-40992620 GCTTCGCTCTGACCCTGTCTGGG + Intergenic
1054340658 9:63859284-63859306 GCTTCGCTCTGACCCTGTCTGGG - Intergenic
1056890694 9:90488950-90488972 CCTTCCTTCTGACCTGGGCCTGG - Intergenic
1061146186 9:128800222-128800244 GCTTCCGCCTGAGCAGGCCTAGG + Intronic
1061481522 9:130899657-130899679 GCGTCCGCCTGACCAGGTCCAGG + Intergenic
1061894240 9:133638877-133638899 TCTTCCATGTGACCTGGCCTCGG + Intronic
1062525255 9:136975677-136975699 GCTTCCGTCTGGGCAGGCCTGGG - Intergenic
1190286926 X:48967486-48967508 GCCTCTGTCTTACCTGCTCTAGG + Intronic
1198531963 X:137556546-137556568 GCTTCTGACTCACTTGGTCTAGG - Intergenic
1200236525 X:154470368-154470390 GCCTCCATCTGTCCTGCTCTGGG + Intronic