ID: 1173761918

View in Genome Browser
Species Human (GRCh38)
Location 20:45569214-45569236
Sequence TTCTCCCTTTAGGAGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173761909_1173761918 22 Left 1173761909 20:45569169-45569191 CCAGGTCTTACCTCTTCAGTGGA 0: 1
1: 0
2: 0
3: 15
4: 123
Right 1173761918 20:45569214-45569236 TTCTCCCTTTAGGAGAGGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 264
1173761907_1173761918 23 Left 1173761907 20:45569168-45569190 CCCAGGTCTTACCTCTTCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1173761918 20:45569214-45569236 TTCTCCCTTTAGGAGAGGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 264
1173761910_1173761918 12 Left 1173761910 20:45569179-45569201 CCTCTTCAGTGGATTTCATCTTC 0: 1
1: 1
2: 1
3: 29
4: 247
Right 1173761918 20:45569214-45569236 TTCTCCCTTTAGGAGAGGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173761918 Original CRISPR TTCTCCCTTTAGGAGAGGGA GGG Intronic
900680103 1:3911892-3911914 GTCTCCCTTGAGGGGAGGGCTGG + Intergenic
901479397 1:9514292-9514314 TTCTCGCTGTTGGAGAGGGGAGG + Intergenic
902413796 1:16227184-16227206 CTCTCCCAGGAGGAGAGGGAAGG + Intergenic
903573885 1:24325852-24325874 TCCTCCATTTAGGAGAGAGCAGG - Intronic
904228075 1:29041305-29041327 TTGTACCTTTAGTAGAGGCAGGG - Intronic
904364185 1:29999977-29999999 TTGTCCCTTGAGGAGATGCATGG + Intergenic
904425489 1:30420069-30420091 TTCTCCCTAGAGGAGAAGGTGGG - Intergenic
905883966 1:41481880-41481902 TTCTCCATGTGGGTGAGGGAAGG + Intronic
906546390 1:46622243-46622265 TTCTTCCCTTCAGAGAGGGACGG + Intergenic
906614923 1:47227479-47227501 TTCTCCCTTCTGGGGTGGGAGGG - Intronic
908252268 1:62274516-62274538 TTCACCCTGAAGGGGAGGGAGGG + Exonic
908381417 1:63600342-63600364 TTCTCCCTTTCTGAGATAGAGGG + Intronic
909829216 1:80164556-80164578 TTCTCCGTGAAGGCGAGGGAGGG - Intergenic
910012902 1:82487191-82487213 GTCTCCCAGGAGGAGAGGGAGGG + Intergenic
910038331 1:82816379-82816401 TTCTCACTGAAGGAGAAGGAAGG + Intergenic
911842235 1:102697798-102697820 TTTTCCTCTTGGGAGAGGGAGGG - Intergenic
913057237 1:115174005-115174027 TTCTATCTGTAGGAGAGGGATGG + Intergenic
915559067 1:156676060-156676082 TCCTCCCCTCAGGAGAAGGAGGG + Intronic
916357085 1:163923828-163923850 CTCTTCCTTTGGGAGAGTGAGGG + Intergenic
917561018 1:176155780-176155802 TACTAGCTTTAGGAGAAGGATGG + Intronic
917695898 1:177523728-177523750 TTCTCCCTTTAGTTGGTGGATGG + Intergenic
917816524 1:178715296-178715318 TTCTCCCTTTAGGGTGGGGGTGG + Intergenic
918136805 1:181681091-181681113 TTCACCCTTGAGGGGAGGCACGG - Intronic
920127037 1:203701505-203701527 TTCTTCCCTTAGGGGAGAGAAGG + Intronic
920127765 1:203707245-203707267 CTCTTCCTTTAGGATAGAGATGG + Intronic
921271454 1:213474013-213474035 CTCTTCCTTAAGGAGAGAGAGGG - Intergenic
922561040 1:226569788-226569810 TTCTGCCTTCAGGACTGGGAGGG + Intronic
923119859 1:230979604-230979626 TTCTCCCTTTGACAGAGAGATGG + Intronic
923243685 1:232110594-232110616 TTCTCCCCTTAGGAGGGGAAAGG - Intergenic
923364309 1:233244833-233244855 TTCTCCTTTTATAAGTGGGAAGG - Intronic
923715394 1:236421061-236421083 TTCACCCTGTTGGTGAGGGAGGG + Intronic
924434093 1:244023311-244023333 TTCACCCTTTTGGAGCGGAAAGG + Intergenic
924671288 1:246128723-246128745 TTCTCCCTTTAGGGGGTGAAAGG + Intronic
1066350708 10:34634409-34634431 TTTTCCCTCCAGGGGAGGGAAGG + Intronic
1068576566 10:58690355-58690377 TTCTCCCATGAGGAGACTGAAGG + Intronic
1068745232 10:60522667-60522689 ATCTCCATTTAGGAGAGGATAGG - Intronic
1070144173 10:73761684-73761706 TTCTCACTGAAGGAGGGGGAAGG - Intronic
1070407090 10:76106673-76106695 TGCTCCTTGTAGGAGACGGAAGG + Intronic
1070533245 10:77355829-77355851 TTCTCCTTTTACCAGAAGGATGG - Intronic
1070959161 10:80486888-80486910 TTTTCCCTTCAGGGGAGGGTTGG - Intronic
1070960349 10:80495168-80495190 TCTTCCCTTTAGGGAAGGGAGGG + Intronic
1073812089 10:107163464-107163486 TTCTCCCTTGTGGAGAAGAAGGG + Intronic
1074638054 10:115344366-115344388 TTCTGCCTTTGGAAAAGGGAGGG - Intronic
1074708254 10:116155345-116155367 TTCCCCCTCTAGCAGAGGGAAGG + Intronic
1075024862 10:118977119-118977141 TTCTTCTTTTAGGACACGGATGG - Intergenic
1075048043 10:119161517-119161539 TTCTACCTTTCAGAGAGTGAAGG + Intronic
1075315664 10:121451161-121451183 TTCTGCTTTGGGGAGAGGGAGGG - Intergenic
1077955438 11:7014611-7014633 CTGCCCCTTTAGGAGAGGGGTGG + Intronic
1078949892 11:16118289-16118311 GTTTCCCTTTTGGAGAGGGTGGG + Intronic
1079272231 11:18999538-18999560 TTCTGCCTTTGTGAGGGGGAGGG - Intergenic
1080410148 11:32015603-32015625 TTTTCCATTTATGAGAGGGATGG + Intronic
1080524247 11:33098161-33098183 CTCTCCCATTGGGAGAGGAAGGG - Intronic
1081187251 11:40058976-40058998 TTCTCCCTAGAGGAATGGGAGGG - Intergenic
1081977297 11:47243793-47243815 CTATTCATTTAGGAGAGGGAGGG + Intronic
1083001127 11:59291706-59291728 TTCTCATTTCAGGAGAGTGAAGG - Intergenic
1084010528 11:66346024-66346046 TTCTCAGATTAGGGGAGGGAAGG + Exonic
1084135963 11:67182225-67182247 TACTCCTTTTAGGGGAAGGAAGG - Intronic
1086876580 11:92103761-92103783 TGCTCCCTTTAGGGCAGGAAGGG + Intergenic
1086911720 11:92479936-92479958 TTCACCCTGTTGGTGAGGGAGGG - Intronic
1088521851 11:110710614-110710636 TTTTCCCCTTCGGAGATGGAGGG - Intronic
1089499031 11:118922142-118922164 TTCTCCCAGGAGGGGAGGGAGGG + Intronic
1091960941 12:4693603-4693625 TTCTACTTTCAGGAGAGTGATGG + Exonic
1092059250 12:5535150-5535172 CTGTAGCTTTAGGAGAGGGATGG + Intronic
1092775374 12:11940815-11940837 TTCTTTATTTTGGAGAGGGAGGG - Intergenic
1093946446 12:25115107-25115129 TTTTCCCTTGAGGAGTGGCAAGG - Intronic
1094658136 12:32440883-32440905 TTCTGCCTTTGGAAAAGGGAGGG - Intronic
1095938819 12:47712553-47712575 TTCTACCTGGAGGAGAAGGAGGG - Exonic
1098236238 12:68421127-68421149 TTCTTCCTTCAATAGAGGGAGGG - Intergenic
1098964533 12:76772858-76772880 TTGTTTCTTTGGGAGAGGGATGG + Intronic
1099094025 12:78350732-78350754 TTTCCCATTGAGGAGAGGGATGG + Intergenic
1099721802 12:86371605-86371627 TTCTGCCTATGGGATAGGGAGGG - Intronic
1103043928 12:117719552-117719574 TTCCCCCTTTAGATGAGGCATGG + Intronic
1103587722 12:121968543-121968565 TTCTCCATTCAGGGCAGGGAGGG - Intronic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1105698405 13:22914355-22914377 TTCTCTCTCTAGGAGTGGAATGG - Intergenic
1105850064 13:24326594-24326616 TTCTCTCTCTAGGAGTGGAATGG - Intergenic
1109503316 13:63267090-63267112 TTCTCCCTTTTGGAATGGGAAGG - Intergenic
1110497703 13:76188885-76188907 TACTCCCTTTAGGGAATGGAGGG - Intergenic
1112110081 13:96286690-96286712 ATCTCCCATCAGGAGAGTGAAGG - Intronic
1112395676 13:99028542-99028564 TTCTTGCTTTTGGAGAGGGAGGG + Intronic
1115913191 14:38279529-38279551 ATCTCCCTATAGGATAGAGAGGG + Intergenic
1117657769 14:57973939-57973961 CTCTCCGTTTTGGAGAGTGATGG - Intronic
1117804755 14:59480248-59480270 TTCTCCCTTGAGAAGAGTGGAGG + Intronic
1118043504 14:61941716-61941738 TTGTCCATTTGGGAAAGGGATGG - Intergenic
1118080110 14:62348925-62348947 TTCTCCCTTTTGGAATGGAAAGG + Intergenic
1118137352 14:63045021-63045043 CTCCCCCCTTGGGAGAGGGATGG + Intronic
1118388504 14:65276830-65276852 TTATCCCTTTACAAAAGGGAGGG - Intergenic
1120231256 14:81843935-81843957 TTCTCCCTTTTGGTATGGGAAGG - Intergenic
1120844694 14:89115624-89115646 GTCTCCCCTTAGGAGGGGGGGGG - Intergenic
1128940023 15:71780477-71780499 TTCTCTCTGTAGAAAAGGGATGG + Exonic
1129084431 15:73073635-73073657 CTCTCCTTTAACGAGAGGGAAGG + Intronic
1129832458 15:78679669-78679691 TTCTCCCTTCTGGAAAGGGAGGG + Intronic
1129933168 15:79428923-79428945 TCCTGTCTTTAGGGGAGGGAAGG - Intergenic
1130783954 15:87074888-87074910 TTCTCTGTGGAGGAGAGGGAGGG + Intergenic
1130967957 15:88711079-88711101 TTGTACCTTTAGTAGAGGTAGGG + Intergenic
1131283533 15:91039745-91039767 TCCTCCCTTCTGGAAAGGGAGGG - Intergenic
1131513383 15:93062095-93062117 TTACCCCTTTAAGAGAGGGCAGG - Intronic
1132686867 16:1165857-1165879 TGCTCCCCTTGGGAGAGGGGTGG + Intronic
1134083101 16:11337928-11337950 TTCTCCCATAACGGGAGGGAGGG + Intronic
1134249077 16:12561826-12561848 TTCTCCCTGCAGGGGAGGGGAGG + Intronic
1136142041 16:28293898-28293920 TACTCCCTGTGGGACAGGGAGGG + Intronic
1136474481 16:30504220-30504242 TTCTCTCTTTGGGAGGAGGAAGG + Exonic
1137717474 16:50607353-50607375 TTTTCCCCTAAGGAGAGGGTTGG + Intronic
1138301154 16:55930850-55930872 TTCTCCCTTGAGAAGGGGAATGG + Intronic
1138496076 16:57410223-57410245 TTCTCCCTGAAAGACAGGGAAGG - Intronic
1139877496 16:70157874-70157896 CTCTCCCTTTAGAATAGGGAGGG + Exonic
1140646575 16:77038092-77038114 TTCTGCCTTTGGAAGGGGGAGGG - Intergenic
1140685923 16:77434345-77434367 TTCTCTCTTTGGGGGAAGGAAGG + Intronic
1141914443 16:87085445-87085467 TTCTCTCCCCAGGAGAGGGATGG + Intronic
1144009892 17:11137019-11137041 CACTCTCTTTAGTAGAGGGAGGG + Intergenic
1144899345 17:18569516-18569538 TTACCCCTTTAAGAGAGGGCAGG + Intergenic
1145108865 17:20143944-20143966 TTCTGCCATTAGTGGAGGGAGGG + Intronic
1145884550 17:28372897-28372919 TTCTCTCATTGGGAGAGGGATGG - Intronic
1147155843 17:38544156-38544178 GTCTCCCTGCAGGAGAGGGGTGG + Intronic
1147203503 17:38820323-38820345 ATCTCCTTTTATGAGATGGATGG + Intronic
1148334856 17:46834360-46834382 TTCTGCCTCTGGGAGAGGGCAGG + Intronic
1148369182 17:47082711-47082733 TTCTCCTTTTCTGAGAGGCAGGG + Intergenic
1148859174 17:50595225-50595247 TTCCCCCTTGAGGACACGGAAGG + Intronic
1149611783 17:57962699-57962721 TGCTCCCTTTAGGGTAGGGAAGG + Intergenic
1151197604 17:72442838-72442860 TCCTCCATTTAGTATAGGGATGG + Intergenic
1151204241 17:72493852-72493874 TTCTCCATGTAAGAGAGAGAGGG - Intergenic
1152246467 17:79187254-79187276 CACTCCCTTTAGGGGAGGAAGGG + Intronic
1152307981 17:79532254-79532276 TTCTGCCTTTAGGAGCTGCAGGG - Intergenic
1152799533 17:82324366-82324388 TTCTTCCTTTGGGAGGGGCAGGG - Intronic
1153987559 18:10367096-10367118 TTCTCCCCTTGGGAGAGGGGTGG - Intergenic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1157249635 18:46083265-46083287 TTCTACTTTTTGTAGAGGGAGGG - Exonic
1157443944 18:47730950-47730972 TTCACCCTGTCGGAGAGGGTGGG + Intergenic
1159034170 18:63261303-63261325 TTCTTCCTCCAGGAGAGGAAGGG - Intronic
1160774224 19:847782-847804 GTCTCCCTGGAGGACAGGGACGG - Exonic
1162519872 19:11173480-11173502 CTCCCCCAGTAGGAGAGGGAAGG + Intronic
1164177150 19:22785159-22785181 CTCTGACCTTAGGAGAGGGAAGG + Intergenic
1164554429 19:29240237-29240259 TTCTCCCTTTGGGGGAAAGAAGG - Intergenic
1165712774 19:38024001-38024023 TTCTTCCTTGGGGAGGGGGAGGG + Intronic
924978060 2:195981-196003 TTCTCATTTTGAGAGAGGGAGGG + Intergenic
925381872 2:3433909-3433931 TTCTCCCTGCAGGAGAGAGACGG + Intronic
926511429 2:13785090-13785112 TAGTTGCTTTAGGAGAGGGATGG - Intergenic
930283668 2:49401657-49401679 TTCTCCCTTTAGAAGGGCCAGGG - Intergenic
931397332 2:61899243-61899265 TCCTCCCTTTACCAGAAGGAAGG + Intronic
932046551 2:68356350-68356372 TTCTCCCTATTTGGGAGGGAAGG + Intergenic
935239826 2:101168710-101168732 TTCTCCCTTTTGGAATGGGAAGG + Intronic
937085287 2:119167624-119167646 TTCTGCCTGTTGGAGAGGGCTGG - Intergenic
937094471 2:119226463-119226485 TCCTCCCTCTAGGAGTTGGAAGG + Intronic
938692723 2:133807311-133807333 TTCTGCCTTGAGAAGAGGAAAGG + Intergenic
939061808 2:137431423-137431445 TCATCCCTTTAGGATTGGGAGGG + Intronic
939868779 2:147504850-147504872 TACTCCCTTGAGGGGAGTGAGGG + Intergenic
942275326 2:174317975-174317997 TTCTACTTTTAGTAGAGGCAGGG - Intergenic
943023494 2:182601987-182602009 CCCTACCTTTAGGACAGGGAGGG - Intergenic
943700207 2:190981023-190981045 TCCTCTCTTTAGAGGAGGGAGGG - Intronic
944675240 2:202030000-202030022 CTCTCCCTCTGAGAGAGGGAGGG - Intergenic
945203827 2:207310783-207310805 GTCTCCTTTTGGGAGAAGGAAGG + Intergenic
945230390 2:207582719-207582741 TTCTCTTTTTAGTAGAGAGAGGG - Intronic
945585481 2:211656374-211656396 TCATCCTTTTAGGAGAGAGAAGG - Intronic
947469899 2:230391851-230391873 TTCACCCATGAGGAGAGTGATGG - Intronic
1172821572 20:37739742-37739764 TGTTCCTTTTAGGAGATGGACGG + Intronic
1173277321 20:41596212-41596234 GACTCCTTTTAGGAGAGGAAAGG - Intronic
1173761918 20:45569214-45569236 TTCTCCCTTTAGGAGAGGGAGGG + Intronic
1175079424 20:56406711-56406733 TTCTATCTTTAGGAGAGACAGGG + Intergenic
1175645188 20:60664877-60664899 GGCTCCCTTTAGAGGAGGGAGGG + Intergenic
1176120030 20:63450178-63450200 TCGTCCCTTTGGGTGAGGGAGGG - Intronic
1176235734 20:64052651-64052673 TTCACCCTTGAGGAGCAGGAGGG - Intronic
1178840802 21:36136104-36136126 ATCTTCCTTAAGGAGAGGGGCGG + Intronic
1181008529 22:20026459-20026481 TTCTCATTTTGGGACAGGGAGGG + Intronic
1181287389 22:21763818-21763840 ATCTCACTTTATGATAGGGAAGG - Exonic
1184638651 22:45856769-45856791 TTCTCTCTCTGGGAGAGAGAGGG + Intergenic
1184796436 22:46736069-46736091 TGGTCCCTCTTGGAGAGGGAGGG - Intronic
950110654 3:10416724-10416746 CTCTGGCTTTATGAGAGGGAAGG + Intronic
950776171 3:15352252-15352274 TTCTCCCTTTTGGAACAGGAAGG + Intergenic
950931045 3:16789180-16789202 TTCTTCCTTTTGGAATGGGAAGG - Intergenic
952466032 3:33586927-33586949 CTCTCACTTTAGGAAAGGGCAGG - Intronic
952906366 3:38141600-38141622 TCCTCACTTGAGGAGTGGGATGG + Exonic
952914377 3:38222121-38222143 TTCACCCTGTTGGTGAGGGAAGG + Intronic
953784829 3:45903555-45903577 GTCTCCCCTTTGGAAAGGGATGG - Intronic
954119828 3:48490842-48490864 TACTCTCTTTAGGATTGGGAGGG - Intronic
954481935 3:50807407-50807429 AACGCCCTTCAGGAGAGGGAAGG - Intronic
954785337 3:53088440-53088462 TTGTCCCTTTTGGAGGGAGAAGG + Intronic
959626431 3:108457271-108457293 TTCTCCGTGCAGGAGGGGGAAGG + Intronic
961037580 3:123653291-123653313 TTCCCTCTTCAGCAGAGGGATGG + Intronic
961273771 3:125710382-125710404 TTCTCTTTTTAGGAGAGGCGGGG - Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963836931 3:150067567-150067589 TTCTCCCTTCAGGTGAGGTGTGG - Intergenic
965765980 3:172130477-172130499 TTCTCCCTGAAGAAGTGGGATGG + Intronic
968806383 4:2775730-2775752 TTCTCCTGTAAGGAAAGGGAAGG - Intergenic
970729362 4:19084738-19084760 TTCTCAGTTTAGGAGCGTGAAGG + Intergenic
971367320 4:25987803-25987825 TTCTCCATATAGGAGAGGAGAGG - Intergenic
971712741 4:30137833-30137855 TTGTCCTTTTAAGAAAGGGAAGG - Intergenic
972902420 4:43700976-43700998 TTTTCCCTTGAGGAGAGGAGAGG - Intergenic
973138464 4:46735677-46735699 TTTTGCCTGTAGGAGGGGGAAGG - Intronic
974302735 4:60089842-60089864 TTTTGCCTTTTGGAGAGGGCTGG - Intergenic
974540402 4:63226042-63226064 TTCTCCCTTTTGGAATGGGACGG + Intergenic
975109473 4:70607754-70607776 TTCTTCCTCTTGGAGAGTGAGGG - Intergenic
977061108 4:92257474-92257496 TTCTTCCTTTTGGACAGGGTGGG + Intergenic
978771209 4:112457922-112457944 TTCTCCCTTCAGCAGAGGCCAGG + Intergenic
979325864 4:119378823-119378845 ATCTCCCTGTGGCAGAGGGAGGG + Intergenic
980857505 4:138456860-138456882 TTCTGTCATGAGGAGAGGGATGG + Intergenic
981298322 4:143157952-143157974 CTCTCTCTTTAGTAGAGGGAGGG + Intergenic
981509803 4:145543583-145543605 TTCCCCCTTTAGTAAAGGGTGGG + Intronic
982230530 4:153204670-153204692 TTTTCCCTGCAGAAGAGGGAAGG + Intronic
983444363 4:167830524-167830546 TTCTCCCTTCAGTATAAGGAAGG - Intergenic
984448585 4:179869922-179869944 CTCACCCTTTTGGAGAGGGATGG + Intergenic
984727646 4:183036770-183036792 TTCTCCCCTAAGCACAGGGAGGG + Intergenic
985444339 4:190012849-190012871 CTCTGCCTTTAGGAAAGGAAGGG + Intergenic
985971999 5:3385569-3385591 TTGTCCATTTATGAAAGGGAGGG + Intergenic
989381516 5:40813693-40813715 TTCTCCCTGTTGGTGAAGGAGGG + Intergenic
989639547 5:43569749-43569771 TTCTCTCCATAGGAGAGGAAAGG - Intergenic
990763038 5:59151693-59151715 TTCTACCTTAGGGAGAGAGATGG + Intronic
992178445 5:74173536-74173558 TTCTGCCTTATGGAGAGAGATGG - Intergenic
997202711 5:132022026-132022048 ATCACCCTTTTGGGGAGGGAAGG + Intergenic
999290182 5:150419855-150419877 TTGTCCCTCAAGGAGGGGGACGG - Intergenic
1000164547 5:158635138-158635160 TTCTCCCTCTTGCACAGGGAAGG + Intergenic
1001480691 5:172087193-172087215 TTCTCCCTCTAGGAGACAGAGGG - Intronic
1002458676 5:179361463-179361485 TTCTCCCTCTAGGACAGGCTGGG - Intergenic
1003515078 6:6811133-6811155 ATCTCCCTTTTGCAGAGGGTGGG - Intergenic
1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG + Intergenic
1004624113 6:17358602-17358624 TTCTCCCTTTGGAATAGGAATGG + Intergenic
1004830532 6:19472777-19472799 TTCCTCCATTTGGAGAGGGATGG + Intergenic
1005944141 6:30583534-30583556 TTCTCCCTTTGGGACAGGAGCGG - Intronic
1006076364 6:31535071-31535093 TTCTCCCTTTGGGGGAGGGCAGG - Intronic
1006297328 6:33175676-33175698 TTCGCCCTGTGTGAGAGGGAAGG + Exonic
1007243541 6:40443836-40443858 TTGTCCCTTTAGGCTAGGGGTGG - Intronic
1007937731 6:45748274-45748296 CTCTCCCTTTGGGAGTGGGATGG - Intergenic
1008530517 6:52453408-52453430 TTCTCCCTTTAGTACAGAAAGGG - Intronic
1013849624 6:114498298-114498320 TTATCCCTTTATGAGAGGAGAGG + Intergenic
1014801867 6:125787511-125787533 TTCTTCCTTTAAGAGAGGAAGGG + Intronic
1016683419 6:146855783-146855805 TTCTCCCTTTGGAAGACAGAAGG - Intergenic
1018438430 6:163784541-163784563 TTCTTCCTTTATGAGAGTTAGGG - Intergenic
1020485441 7:8714843-8714865 TTCCTACTTTAGGAGAGGGGAGG - Intronic
1020748708 7:12111940-12111962 TTCTCCCTCTTGGGCAGGGAAGG - Intergenic
1021168316 7:17367982-17368004 TTCTCCTTCTAGGAGGTGGAAGG + Intergenic
1024386605 7:48759171-48759193 TTCTCTCTGTAGGGGAGAGAGGG - Intergenic
1027520518 7:79200785-79200807 TTCTGCCTGTTGGAGTGGGAAGG - Intronic
1027826098 7:83118525-83118547 TTCTACCCTTGGAAGAGGGAGGG + Intronic
1030757218 7:113301640-113301662 TTCTCCATGTAGTAGAGGAATGG - Intergenic
1031426431 7:121610944-121610966 TTCTGGCTATAGGAGAGGAAGGG - Intergenic
1033807694 7:144973311-144973333 TTCTCCCTCTTGGGGAGTGAGGG + Intergenic
1033948012 7:146746070-146746092 TACTCCCTTTTGGAGAACGATGG - Intronic
1034591907 7:152148107-152148129 TGCTCCATTGAGGAGAAGGATGG - Exonic
1036700900 8:11013306-11013328 TTCTCCTTTAAGGAGAGGAGAGG + Intronic
1037605410 8:20433916-20433938 TTCTCCCATCAGGGGAGGGATGG + Intergenic
1038662751 8:29511330-29511352 TTGTTGCTTTAGGAAAGGGATGG + Intergenic
1038672171 8:29591390-29591412 TTCTCCCTTTGGGCGGGGCATGG + Intergenic
1038905157 8:31893372-31893394 TTCTCCTTATAGTAGAGTGAAGG + Intronic
1039095933 8:33885431-33885453 TTTTTTCTTTAGGAGAGAGAGGG + Intergenic
1040032511 8:42838809-42838831 TTCTACCTGAAGTAGAGGGACGG + Intronic
1040500947 8:48004701-48004723 TTCTATTTTTAGTAGAGGGAGGG + Intergenic
1042498966 8:69488648-69488670 TTCACCCTGTTGGTGAGGGAGGG + Intronic
1042653642 8:71070435-71070457 TAATCCCTTTTGGAGAAGGATGG + Intergenic
1042984857 8:74572085-74572107 TTCTGCTTTCAGGAGAGGAAAGG + Intergenic
1047354896 8:124111264-124111286 TTTTCCCTTTAGGAGGTGTAAGG - Intronic
1047913602 8:129557924-129557946 TTGACCCTTTAGGAAAGGCATGG - Intergenic
1049015743 8:139918812-139918834 TTCTGCCGTTTGGAGAGGGAGGG - Intronic
1049223052 8:141436595-141436617 TTCCCCCTTTGGCAGAGGAAGGG + Intergenic
1049434654 8:142580972-142580994 TACTCCCTTTGGGTTAGGGAGGG + Intergenic
1050244989 9:3680032-3680054 ATCTACCTTTAGGTGAGGGTTGG - Intergenic
1050405977 9:5309106-5309128 TTCACCCTGTTGGAGTGGGAGGG - Intergenic
1052476791 9:28970979-28971001 TTTCCCCTTGAGGAGAGGAAAGG + Intergenic
1052730883 9:32283832-32283854 CTCTCCCTTTATCAGTGGGAAGG + Intergenic
1054770911 9:69083060-69083082 TTCTCTTTCTAGTAGAGGGAGGG - Intronic
1055265293 9:74488571-74488593 TTTTCCCTTCTGGAGAGAGATGG - Intergenic
1055464774 9:76553703-76553725 TTCTCCCTCCATGATAGGGATGG - Intergenic
1057042905 9:91860166-91860188 TTCGCCATCTGGGAGAGGGAAGG + Intronic
1057568445 9:96185216-96185238 CTCTCCCCTTAAGAGTGGGAGGG - Intergenic
1057853431 9:98583149-98583171 TGCTCCCTTTAGGGGAGCCAGGG - Intronic
1058688399 9:107498792-107498814 TTCTCCCTCCAGGAAAAGGAGGG + Intergenic
1060626336 9:125115763-125115785 TTCTTCCAATAGGAGAGGGAAGG + Intronic
1060910718 9:127347879-127347901 CTCTCCCTTTAGGAAATGCACGG - Intronic
1061923227 9:133793559-133793581 TTCTGCCTTTGGGAGGGGGGTGG - Intronic
1185747780 X:2585464-2585486 TACTCTCTTTAAGGGAGGGAGGG + Intergenic
1186841547 X:13489112-13489134 TTCTCACTTAGGGAGATGGAAGG + Intergenic
1187063957 X:15814791-15814813 TTATCCCTTTAGGACAGTGGGGG - Intronic
1188094771 X:26007847-26007869 TTCTCACTATTGGAGTGGGAAGG + Intergenic
1190125931 X:47705454-47705476 TAGTGCCTTTAGGAGAGTGAGGG + Intergenic
1190537836 X:51447072-51447094 GCCTGCCTTTAGGAGAGGGGTGG + Intergenic
1192434985 X:71137546-71137568 TTCTCCCTTTAGCAGAGTCAGGG + Exonic
1193238982 X:79143934-79143956 ATCTACCTTTAGGAGTGGGGAGG + Intergenic
1194427811 X:93761906-93761928 TTTCCCTTTTATGAGAGGGATGG + Intergenic
1195630311 X:107048985-107049007 TTTTTCCTTTTAGAGAGGGAAGG + Intergenic
1196292738 X:113962423-113962445 ATCTCCCTTAAGGTGAGGGTAGG - Intergenic
1197139171 X:123097090-123097112 CTCTGCCTTTGGAAGAGGGAGGG + Intergenic
1197876480 X:131114404-131114426 TTCTGCCTTTGGTAAAGGGAGGG - Intergenic
1198681917 X:139192013-139192035 GTCTCCCTTTAGGAGAAAGTAGG - Intronic
1200410865 Y:2860236-2860258 TTATCTCTTTAGGATTGGGAGGG - Intronic
1200756384 Y:6994026-6994048 TTCTCCCTTTTGGAAATGTAAGG + Intronic
1201059221 Y:10029510-10029532 TTGTACCTTTAGGAGAGACAGGG + Intergenic
1201891770 Y:18950194-18950216 TAATCTCTTTAGGATAGGGAGGG + Intergenic
1202112398 Y:21436198-21436220 TTATACCTTTAGGAGAGACAGGG + Intergenic
1202173671 Y:22077786-22077808 TACTCACTCTAGGAGAGAGAAGG + Intronic
1202217690 Y:22508596-22508618 TACTCACTCTAGGAGAGAGAAGG - Intronic
1202325495 Y:23687463-23687485 TACTCACTCTAGGAGAGAGAAGG + Intergenic
1202545276 Y:25982591-25982613 TACTCACTCTAGGAGAGAGAAGG - Intergenic