ID: 1173763763

View in Genome Browser
Species Human (GRCh38)
Location 20:45587606-45587628
Sequence GCCAAGGAATGCCGTAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173763763_1173763771 17 Left 1173763763 20:45587606-45587628 CCTGGGCTACGGCATTCCTTGGC No data
Right 1173763771 20:45587646-45587668 GGCACTTGTAGCAAGCTCCTGGG 0: 307
1: 190
2: 139
3: 92
4: 278
1173763763_1173763774 26 Left 1173763763 20:45587606-45587628 CCTGGGCTACGGCATTCCTTGGC No data
Right 1173763774 20:45587655-45587677 AGCAAGCTCCTGGGGGATGCAGG No data
1173763763_1173763773 19 Left 1173763763 20:45587606-45587628 CCTGGGCTACGGCATTCCTTGGC No data
Right 1173763773 20:45587648-45587670 CACTTGTAGCAAGCTCCTGGGGG 0: 303
1: 184
2: 210
3: 143
4: 198
1173763763_1173763772 18 Left 1173763763 20:45587606-45587628 CCTGGGCTACGGCATTCCTTGGC No data
Right 1173763772 20:45587647-45587669 GCACTTGTAGCAAGCTCCTGGGG 0: 337
1: 259
2: 196
3: 91
4: 158
1173763763_1173763767 -4 Left 1173763763 20:45587606-45587628 CCTGGGCTACGGCATTCCTTGGC No data
Right 1173763767 20:45587625-45587647 TGGCCTGGTGGCCAGATTTCTGG 0: 155
1: 186
2: 345
3: 97
4: 168
1173763763_1173763770 16 Left 1173763763 20:45587606-45587628 CCTGGGCTACGGCATTCCTTGGC No data
Right 1173763770 20:45587645-45587667 TGGCACTTGTAGCAAGCTCCTGG 0: 278
1: 142
2: 126
3: 107
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173763763 Original CRISPR GCCAAGGAATGCCGTAGCCC AGG (reversed) Intergenic
No off target data available for this crispr