ID: 1173763767

View in Genome Browser
Species Human (GRCh38)
Location 20:45587625-45587647
Sequence TGGCCTGGTGGCCAGATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 951
Summary {0: 155, 1: 186, 2: 345, 3: 97, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173763755_1173763767 28 Left 1173763755 20:45587574-45587596 CCCGCACAGACGGGACACAGCTT No data
Right 1173763767 20:45587625-45587647 TGGCCTGGTGGCCAGATTTCTGG 0: 155
1: 186
2: 345
3: 97
4: 168
1173763763_1173763767 -4 Left 1173763763 20:45587606-45587628 CCTGGGCTACGGCATTCCTTGGC No data
Right 1173763767 20:45587625-45587647 TGGCCTGGTGGCCAGATTTCTGG 0: 155
1: 186
2: 345
3: 97
4: 168
1173763756_1173763767 27 Left 1173763756 20:45587575-45587597 CCGCACAGACGGGACACAGCTTA No data
Right 1173763767 20:45587625-45587647 TGGCCTGGTGGCCAGATTTCTGG 0: 155
1: 186
2: 345
3: 97
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173763767 Original CRISPR TGGCCTGGTGGCCAGATTTC TGG Intergenic
900840798 1:5047127-5047149 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
900847485 1:5115402-5115424 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
902050926 1:13563160-13563182 TGGCCCAGTGGCTAGATATCCGG - Intergenic
902970410 1:20044122-20044144 TGGCCCAGTGGCCAGATTTCTGG + Intronic
903396017 1:23002378-23002400 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
903730172 1:25487820-25487842 TGGCCTGGTGGGAAGTTTGCTGG + Intronic
904393967 1:30205672-30205694 TGGCACAGTGGCCAGATTTCTGG - Intergenic
904996470 1:34635388-34635410 TGGCCCAGTAGCCAGATTTCCGG + Intergenic
905060511 1:35135761-35135783 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
905499788 1:38427361-38427383 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
905536527 1:38726624-38726646 TGGACTGGAGGCCAGAGTTAAGG + Intergenic
906080929 1:43087788-43087810 TGGCCTAGTGGCCAGATTTCCGG - Intergenic
907292641 1:53426576-53426598 TGGCTCAGTGGCCAGATTTCTGG - Intergenic
907293613 1:53434526-53434548 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
907503558 1:54901291-54901313 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
907521269 1:55024880-55024902 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
908461706 1:64353398-64353420 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
908591945 1:65645306-65645328 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
908852415 1:68388545-68388567 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
909014715 1:70369675-70369697 TGGCCCAGTGGCCAGATTACTGG - Intronic
909035484 1:70590584-70590606 TGTCCCAGTGGCCAGATTTCTGG - Intergenic
909374172 1:74921196-74921218 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
909729437 1:78874567-78874589 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
909776683 1:79491993-79492015 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
909788259 1:79642155-79642177 TGGCCTGTTGGCCAAATTTCTGG + Intergenic
909792971 1:79699774-79699796 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
909909970 1:81247719-81247741 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
909978441 1:82070946-82070968 TGGCCCAGTAGCCAGATTTCCGG + Intergenic
910049392 1:82957596-82957618 TGGCCCGGGGGCCAGATTTCCGG - Intergenic
910144123 1:84058653-84058675 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
911071085 1:93832340-93832362 TGGCCCAGTGGCCAGATTTCCGG - Intronic
911147977 1:94570289-94570311 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
911510606 1:98804671-98804693 TAGCCCAGTGGCCAGATTTCTGG + Intergenic
911570407 1:99511917-99511939 TAGGCTGTGGGCCAGATTTCTGG - Intergenic
911714650 1:101117257-101117279 TGGGCTGGAGGGCAGATTACTGG + Intergenic
911759772 1:101601465-101601487 TGGTCCAGTGTCCAGATTTCCGG + Intergenic
911983856 1:104598280-104598302 TGGCTCAGTGGCCAGATTTCTGG - Intergenic
912296483 1:108475231-108475253 TGTCCTGGTGGTCAGATTTCTGG - Intergenic
912378979 1:109236422-109236444 TGACCTGGAGGCCTGGTTTCCGG + Exonic
912813575 1:112811719-112811741 TGGCCGAGTGGCCAGATTTCCGG - Intergenic
914240662 1:145850561-145850583 ATGGCTGGTGGCCAGATGTCAGG + Exonic
915952261 1:160197407-160197429 GGGCCTGGTGCCCAGAGTTGAGG + Intronic
916941800 1:169685147-169685169 TGGCCCAGTGGCCAGATTTCTGG - Intronic
917749663 1:178042257-178042279 TGGCCCGGTGGCCAGATTTCTGG - Intergenic
918043916 1:180929725-180929747 TAGCCTGGTGGCCTCATCTCAGG - Intronic
918347128 1:183615927-183615949 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
918567660 1:185951730-185951752 TGGCCCAGTGGCCAGATTTCCGG + Intronic
918714394 1:187768927-187768949 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
919476407 1:198037073-198037095 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
919914279 1:202130273-202130295 AGGCCTGGTGGGCAGAAGTCTGG - Exonic
921459770 1:215413374-215413396 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
921509266 1:216010286-216010308 TGGCCTGGTGGCCAGATTTCTGG - Intronic
921732962 1:218597223-218597245 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
922048422 1:221968235-221968257 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
922049523 1:221976537-221976559 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
922154057 1:223027837-223027859 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
922363535 1:224843887-224843909 TGGCCCAGTGACCAGATTTCTGG + Intergenic
922877093 1:228948515-228948537 TGGCCCGGTGGCCAGATTTTTGG - Intergenic
922906403 1:229176699-229176721 TGGCCTGGGGGTCAGATTTCTGG - Intergenic
922934832 1:229414664-229414686 TGGCCCGGTGGCCAGATTTCCGG - Intergenic
923075214 1:230603509-230603531 TGGCCTGGGGGTCAGATTTCTGG - Intergenic
923214184 1:231833641-231833663 TGGCCTGGTGGCCAGATTTCTGG + Intronic
923244764 1:232120458-232120480 TGGCCCGGTGGCCAGATTTCCGG - Intergenic
923257264 1:232232635-232232657 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
923728985 1:236532542-236532564 TGGCCTGGGAGACAGGTTTCAGG - Intronic
923770728 1:236935685-236935707 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
923962795 1:239103650-239103672 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
924180664 1:241436251-241436273 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
924592150 1:245414077-245414099 TGGCCTGGGGGCCAGAGATGGGG + Intronic
924896169 1:248339661-248339683 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1062930764 10:1351028-1351050 TGGCCCGGTGGCCAGATTTCTGG - Intronic
1063363177 10:5473391-5473413 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1063509588 10:6633026-6633048 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1064663803 10:17630276-17630298 TGCCCTGGTGGTCAGATTTCTGG + Intergenic
1064886985 10:20122591-20122613 TGGCCTTGTGGCCAGATTTCTGG + Intronic
1065437642 10:25718726-25718748 TGGCCCAGTGACCAGATTTCCGG - Intergenic
1065443109 10:25772171-25772193 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1066437203 10:35405911-35405933 TGGCCCAGTGGCCAGATTTCCGG + Intronic
1067355454 10:45520592-45520614 TGGGCTAGTCACCAGATTTCTGG + Intronic
1067360416 10:45573492-45573514 TCGCCCAGTGGCCAGATTTCCGG - Intronic
1068058339 10:52037196-52037218 TGGCCCAGTGGCCAGATTTCTGG + Intronic
1068360783 10:55973480-55973502 TGACCTAGTGGCCAGATTTCTGG - Intergenic
1069925000 10:71843269-71843291 TGGCCTGCTGTCCAGCCTTCTGG - Intronic
1070474936 10:76820849-76820871 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1071187243 10:83059428-83059450 TGGCCCAGTGGCCAGATTTCGGG - Intergenic
1071389748 10:85160588-85160610 TTTCCTTGTGGCCAGATTCCAGG + Intergenic
1071723478 10:88170905-88170927 TTGCCTCCTGGCCAGATTTTGGG - Intergenic
1071821746 10:89286975-89286997 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1071897723 10:90084472-90084494 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1071916212 10:90297285-90297307 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1071961120 10:90809705-90809727 TGGCCTGGTGGCCAGATTTCTGG - Intronic
1072011266 10:91304919-91304941 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1072091341 10:92130616-92130638 TGGCCAGGTGGCCAGATACATGG - Intronic
1072580270 10:96734492-96734514 TGGCTTGGTGGCCAGATTTCCGG - Intergenic
1072725676 10:97811892-97811914 TGACCTGGTACCCAGACTTCAGG + Intergenic
1072884534 10:99261870-99261892 TGGCACAGTGGCCAGATTTTTGG - Intergenic
1073394627 10:103207845-103207867 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1073709480 10:106021051-106021073 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1073933215 10:108600082-108600104 TGGTCCAGTGGCCAGATTTCAGG - Intergenic
1074019038 10:109564645-109564667 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1074114368 10:110444434-110444456 TGGACTAGTGGACAGATGTCAGG - Intergenic
1074740788 10:116482933-116482955 TGGTCTGGTGACCAGATTTCTGG - Intergenic
1074947009 10:118289798-118289820 AGGCCTGGTTACCAGCTTTCTGG - Intergenic
1075248707 10:120847128-120847150 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1075918575 10:126190772-126190794 TGGCCTTGTGGACAGGTTTGGGG + Intronic
1075955290 10:126518184-126518206 TGGTCTGGGGGCCACATTTTGGG - Intronic
1077589871 11:3483066-3483088 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1077612196 11:3650215-3650237 TGGCCCAGTGGCCAGATTTCCGG - Intronic
1077766373 11:5163716-5163738 TGGCCTGGTGGCCAGATTTCTGG + Intronic
1077883367 11:6368093-6368115 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1077890532 11:6414983-6415005 TGCCCTGGTGACCAGATTGGCGG - Intronic
1078046115 11:7915593-7915615 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1079230524 11:18645309-18645331 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1079447472 11:20570068-20570090 TGGCCCAGTGGTCAGATTTCCGG - Intergenic
1079727064 11:23890614-23890636 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1079847680 11:25490651-25490673 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1080027906 11:27632516-27632538 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1080227369 11:29975688-29975710 TGGCCCATTGGCCAGATTTCCGG - Intergenic
1081159713 11:39736685-39736707 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1081356816 11:42122855-42122877 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1081788391 11:45765083-45765105 TTGCGTGGTGGCCATATGTCTGG - Intergenic
1082197751 11:49324865-49324887 TGGCCCAGTGGCCAAATTTCCGG + Intergenic
1083228351 11:61299071-61299093 TGGCCTGGGGGCTAGATGACTGG + Intergenic
1083619667 11:64042583-64042605 TGGCCTGGTGGCCAGGCCTGTGG + Intronic
1083853742 11:65382076-65382098 TGGCCTGGTGCCCAGACCTCCGG + Intronic
1084047175 11:66575898-66575920 TGGCCTGGTGGCTAGATTTCTGG - Intergenic
1084163875 11:67366159-67366181 GGGCCTGGAAGCCAGATTGCAGG + Intronic
1084232314 11:67761963-67761985 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1084245590 11:67854840-67854862 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1084354201 11:68626422-68626444 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1084355563 11:68635991-68636013 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1084512123 11:69612474-69612496 TGGCCTGGGGGCCATATTCTTGG + Intergenic
1085627296 11:78083256-78083278 TGGCCCACTGGCCAGATTTCTGG - Intergenic
1085811900 11:79690691-79690713 AGGCCTGGGTGCCAGATTTTGGG + Intergenic
1085934277 11:81124103-81124125 TGGCCTGGTGGCCAGATTTCCGG - Intergenic
1085988025 11:81808494-81808516 TGGCCTGGTGGCCAGATTTTTGG - Intergenic
1086005030 11:82027500-82027522 TGGCCCAGTGGCCAGATTTTTGG - Intergenic
1086125299 11:83343516-83343538 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1086133160 11:83421403-83421425 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1086134823 11:83435013-83435035 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1086136259 11:83446335-83446357 TGACCTGGTGGCCAGATTTCTGG + Intergenic
1086550224 11:88045471-88045493 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1086658068 11:89383262-89383284 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1087099110 11:94347999-94348021 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1087099652 11:94351932-94351954 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1087127826 11:94643896-94643918 TGGCTTGGTGGTCAGATTTCTGG - Intergenic
1087196926 11:95311802-95311824 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1087224966 11:95588688-95588710 TGGCATGGGGGCCATATTTTAGG + Intergenic
1087314686 11:96590204-96590226 TGGCCCAGTGGCCATATTTCTGG - Intergenic
1087839531 11:102907511-102907533 TGGCCTAGTGGCCAGATTTCTGG + Intergenic
1088580674 11:111312659-111312681 AGCCCTGGGGGCTAGATTTCGGG + Intergenic
1089471045 11:118720431-118720453 CGGCCTGGTGGTCAGATTTCTGG + Intergenic
1089867038 11:121641356-121641378 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1089953308 11:122549231-122549253 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1089987693 11:122829402-122829424 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1090107589 11:123869030-123869052 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1090526799 11:127546164-127546186 TGGTCTGGTGGCCAGATTTCTGG + Intergenic
1090546479 11:127772508-127772530 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1090570201 11:128037292-128037314 AGGGCTGGTGTCCAGATTTCTGG + Intergenic
1090871949 11:130756942-130756964 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1090926926 11:131257921-131257943 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1091183687 11:133629065-133629087 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1091886529 12:4020810-4020832 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1091967292 12:4755233-4755255 TAGCCTGGTGGCAAGGTTTGTGG + Intronic
1092416166 12:8291971-8291993 TGGCCTGGTGGCCAGATTTCCGG + Intergenic
1092474494 12:8807216-8807238 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1092592744 12:9966499-9966521 TGGCCAGGTGGCCAGATTTCTGG + Intronic
1092723711 12:11465602-11465624 TGGCCCAGTGATCAGATTTCTGG + Intronic
1092739314 12:11613127-11613149 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1092789717 12:12060672-12060694 TGGCCTGGTGGTCAGATTTCTGG - Intronic
1092924845 12:13263403-13263425 TGGCTTGGTGGCCAGATTTTTGG + Intergenic
1093024342 12:14232859-14232881 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1093071154 12:14708306-14708328 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1093302240 12:17471829-17471851 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1093358445 12:18197230-18197252 GGGCCTGGTGGCCAGATTTCTGG - Intronic
1093578825 12:20765656-20765678 TGGCTCAGTGGCCAGATTTTTGG - Intergenic
1093584509 12:20820434-20820456 TGGCCTGGTGGTCAGATTTCTGG + Intronic
1093812824 12:23509444-23509466 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1093951081 12:25165427-25165449 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1094316041 12:29138434-29138456 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1094400688 12:30058257-30058279 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1094825765 12:34267917-34267939 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1095637663 12:44452076-44452098 TGGCCTTGTGGCCAGATTTCTGG - Intergenic
1097398597 12:59104119-59104141 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1097417045 12:59326651-59326673 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1097542191 12:60955415-60955437 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1097592432 12:61589531-61589553 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1098173629 12:67770080-67770102 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1098402260 12:70087680-70087702 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1098630023 12:72712326-72712348 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1098653816 12:73005396-73005418 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1098919915 12:76293739-76293761 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1099049424 12:77765344-77765366 TGGCATGGTACCTAGATTTCAGG - Intergenic
1099140110 12:78962762-78962784 TGGCATGGTGAGTAGATTTCAGG - Intronic
1099188726 12:79542139-79542161 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1099292092 12:80786509-80786531 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1099762596 12:86941079-86941101 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1100940306 12:99717467-99717489 TGGCCTGGTGGCCAGATTTCTGG - Intronic
1103200840 12:119086660-119086682 TGGGCTGGTGCACAGCTTTCTGG + Intronic
1104257613 12:127154072-127154094 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1105032221 12:132891988-132892010 TGGCTCAGTGGCCAGATTTCTGG - Intronic
1106943450 13:34800923-34800945 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1107075588 13:36318722-36318744 TGGCCCAGTGGCCAGATTTCCGG - Intronic
1107220286 13:37972608-37972630 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1107248323 13:38324733-38324755 TGGCCTGGTGGTAAGATGTGGGG - Intergenic
1107683131 13:42870850-42870872 TGGCCCAGTGGCCAGATTCCCGG + Intergenic
1107803159 13:44129592-44129614 TGGCCTGGAGTCCAGCTTTCTGG - Intergenic
1108202706 13:48058677-48058699 TGGCCTAGTGGCCAGATTTCCGG - Intronic
1108282054 13:48870555-48870577 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1108337775 13:49463673-49463695 TGCCCAGGTGGCCATAATTCAGG + Intronic
1108513004 13:51172147-51172169 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1108803862 13:54131123-54131145 TGGCCTCATGGCCAGATTTCTGG + Intergenic
1108913409 13:55581677-55581699 TGGCCCAGTGGCCAGATTCCCGG + Intergenic
1108919537 13:55658406-55658428 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1108947444 13:56042591-56042613 TGGTCCAGTGGCCAGATTTCCGG - Intergenic
1108952937 13:56115850-56115872 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1109070381 13:57758690-57758712 TGGCCTGTGGGGCAGATGTCTGG + Intergenic
1109343589 13:61090636-61090658 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1109352923 13:61207067-61207089 TGGCATGGTGGCAGGATTTCTGG - Intergenic
1109499301 13:63215403-63215425 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1109709657 13:66144769-66144791 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1109716733 13:66229813-66229835 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1110650476 13:77936752-77936774 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1110765486 13:79276415-79276437 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1110845352 13:80185952-80185974 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1111126034 13:83911713-83911735 TGGCCCGGTGGCCAGATTTCTGG + Intergenic
1111302057 13:86360686-86360708 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1111362097 13:87189859-87189881 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1111458829 13:88516257-88516279 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1111630451 13:90841720-90841742 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1111631693 13:90852019-90852041 TGGCCTGGTGGCCACGTTTCTGG + Intergenic
1112236839 13:97644596-97644618 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1112889307 13:104211489-104211511 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1113324346 13:109267627-109267649 TGCCCTGGTGGTCAGATTTCTGG - Intergenic
1115240594 14:31248775-31248797 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1115904819 14:38193071-38193093 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1116490577 14:45498816-45498838 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1116534772 14:46015836-46015858 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1116573463 14:46546207-46546229 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1116613523 14:47106461-47106483 TGGCCCAGTGGCCAGATTTCCGG - Intronic
1116702396 14:48258814-48258836 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1116703280 14:48265806-48265828 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1116952922 14:50895451-50895473 TGGCCCAGTGGCCAGATTTCCGG - Intronic
1117174164 14:53130676-53130698 TGGCCCAGTGGCCACATTTTCGG - Intronic
1117801193 14:59446336-59446358 TGGCCTGGTGGCCAGATTTCTGG - Intronic
1117957904 14:61136854-61136876 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1118937247 14:70299234-70299256 TGGCCTAGTGGCCAGATTTCTGG + Intergenic
1119022442 14:71126606-71126628 TGGCCTAGTGGCCAGATTTCTGG - Intergenic
1119113592 14:71997702-71997724 AGGCCTGGGGGTCAGAGTTCTGG + Intronic
1119317213 14:73705771-73705793 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1119633347 14:76253407-76253429 TATCCTCGTGGCCAGATTCCTGG - Intronic
1120251384 14:82064513-82064535 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1120438043 14:84503637-84503659 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1120539549 14:85736405-85736427 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1120618266 14:86733629-86733651 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1120659946 14:87238469-87238491 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1121193291 14:92048141-92048163 TGGCCCAGTGGCCAGATTTCCGG + Exonic
1121289424 14:92762148-92762170 TGGGCCAGTGGCCAGATTTCTGG - Intergenic
1121630075 14:95415400-95415422 TGGCTTGGTTTCCAGATATCTGG + Intronic
1121859124 14:97299873-97299895 TGGCCTGGTGGAAAGAACTCTGG + Intergenic
1122041006 14:98987479-98987501 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1122507646 14:102241908-102241930 TGGCCCAGTGGCCAGATTTCCGG - Intronic
1122913735 14:104846247-104846269 TTGGCTGGTGGCCAGATTCCTGG - Intergenic
1123882483 15:24689011-24689033 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1124873293 15:33565236-33565258 TGGCCTGGGTCCCAGATTTCTGG - Intronic
1125045784 15:35241050-35241072 TGGCCTGGTGGTCAGATTTCCGG - Intronic
1125131507 15:36289073-36289095 TGGCCTGGTGGTCAGATTTCCGG + Intergenic
1125213206 15:37239627-37239649 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1125297678 15:38220812-38220834 TGGCCTGGAAGCCAGCTCTCTGG - Intergenic
1125629231 15:41133788-41133810 TGGCCCATTGGCCAGATTTCTGG - Intergenic
1125849101 15:42886806-42886828 TGGCCTAGTGGCCAGATTTCCGG - Intronic
1126530144 15:49702568-49702590 TGGCCTGGTGGCCAGATTTCCGG + Intergenic
1126649810 15:50908992-50909014 TGGCCGGGCGGCGAGACTTCAGG + Intronic
1126843756 15:52740867-52740889 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1126912396 15:53430264-53430286 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1126926482 15:53593524-53593546 TGGCAAGGTGGGCAGATTGCTGG + Intronic
1127264759 15:57352493-57352515 TGGCCTGTTGGAAAGATTGCTGG + Intergenic
1128451703 15:67809653-67809675 TGGCCTGGAGACCAACTTTCAGG + Intergenic
1130304560 15:82704532-82704554 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1131108519 15:89750391-89750413 TGGCCAGGTGGCCAGGCTGCCGG + Intronic
1131164879 15:90135118-90135140 TGGCCCGGTGGCCAGATTTCTGG - Intergenic
1131447758 15:92513791-92513813 TGACCTGGTGGCCAGATTTCTGG - Intergenic
1131501731 15:92973970-92973992 AGGTCTGGTGGGCAGAGTTCTGG + Intronic
1131882506 15:96875256-96875278 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1132263024 15:100442567-100442589 TGGCCTGGTGGCCAGATTTCTGG - Intronic
1132340422 15:101074817-101074839 TGGCCTGGTGGCCAGATTTCTGG - Intronic
1133651401 16:7816984-7817006 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1133766754 16:8843512-8843534 GGCCCTGGTAGTCAGATTTCTGG + Intronic
1133805718 16:9124786-9124808 TGGCCAGGTGGGTAGATTTGGGG - Intergenic
1133869535 16:9674545-9674567 TGGCCTGGTGGCTAGATTTCTGG + Intronic
1134342170 16:13356000-13356022 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1134559238 16:15193698-15193720 TGTGCTGGTGGCCATTTTTCTGG + Intergenic
1134919775 16:18105311-18105333 TGTGCTGGTGGCCATTTTTCTGG + Intergenic
1135399404 16:22155799-22155821 CTCCCTGGTGCCCAGATTTCTGG - Intronic
1136529961 16:30861437-30861459 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1137055336 16:35743352-35743374 TGGCCCAGTGGCTAGATTTCTGG + Intergenic
1137363439 16:47840805-47840827 TGGCCCAGTGGCCATATTTCTGG - Intergenic
1138759093 16:59521060-59521082 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1138804960 16:60081113-60081135 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1139039228 16:62982575-62982597 TGGCTCGGTGGCCAGATTTCTGG + Intergenic
1139225906 16:65233264-65233286 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1139230591 16:65278681-65278703 TGGCCCAGTGGCCACATTTCGGG + Intergenic
1139431727 16:66914320-66914342 TGGCCTGGTGGCCTGAGGCCTGG + Exonic
1139943710 16:70624213-70624235 TGGCCCAGTGGCCAGATTTCCGG + Intronic
1141220243 16:82062806-82062828 TGGCTTTGTTGCCAGGTTTCCGG + Intronic
1141865195 16:86745453-86745475 TGGCCTCGTGGTCAGATTTCTGG + Intergenic
1143414337 17:6735034-6735056 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1143970512 17:10792019-10792041 TGGCAGGGTGGACAGAGTTCAGG + Intergenic
1144104681 17:11974176-11974198 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1144511648 17:15882109-15882131 TGGCCTGGAGCCCACATTGCTGG - Intergenic
1145080656 17:19891891-19891913 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1148217157 17:45839592-45839614 TGGCTTGGAGGCCAGATTTGGGG - Intergenic
1149270189 17:54968794-54968816 AGGCCGGGTTGCCAGATTACGGG + Exonic
1149319578 17:55470080-55470102 TGGTCCAGTGGCCAGATTTCCGG - Intergenic
1151279044 17:73058219-73058241 TAGCCTGATAACCAGATTTCAGG - Intronic
1151622497 17:75254855-75254877 TGGCTCGGTGGCCAGATTTCTGG - Intronic
1151839747 17:76609383-76609405 CGGCCTGGTGGTCAGATTTCGGG + Intergenic
1152145396 17:78565501-78565523 TGGGCTGGTGGTCATCTTTCAGG - Intronic
1152444065 17:80330451-80330473 GGGCCTGGCTGCCAGGTTTCTGG + Intronic
1153760815 18:8330194-8330216 AAACCTGGTGCCCAGATTTCTGG - Intronic
1155173828 18:23286321-23286343 TGGCCTGGTGGCCAGATTTCTGG - Intronic
1155697008 18:28696529-28696551 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1155892686 18:31287664-31287686 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1155941558 18:31806086-31806108 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1155962006 18:32002888-32002910 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1156251921 18:35359737-35359759 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1156915822 18:42463850-42463872 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1156924043 18:42555919-42555941 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1156938541 18:42738933-42738955 TGGCCCAGTGGCCAGATTTCGGG - Intergenic
1156958189 18:42993155-42993177 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1157906381 18:51573467-51573489 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1158336386 18:56417872-56417894 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1158394635 18:57070055-57070077 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1158617434 18:59001224-59001246 TGCCCAGGTGGTCAGACTTCAGG + Intergenic
1158873719 18:61712970-61712992 CGGCGTGGAGGCCAGTTTTCAGG + Intergenic
1159164475 18:64683922-64683944 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1159835061 18:73326918-73326940 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1160279478 18:77474284-77474306 TAGCCTGGTGGCCACATATGAGG + Intergenic
1160406247 18:78648398-78648420 TGGTCAGGAGGCCACATTTCTGG - Intergenic
1161661729 19:5550752-5550774 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1161712050 19:5854391-5854413 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1161715428 19:5873659-5873681 GGGCCTGCTGGCCAAATTCCAGG + Intronic
1162790920 19:13062559-13062581 TGGCCTGGTGGCCAGGTCTCTGG + Intronic
1163195465 19:15716575-15716597 TGGCCTGGTGGTAAGAACTCAGG + Intergenic
1163209647 19:15831086-15831108 TGGCCCAGTGGCCAGTTTTGCGG - Intergenic
1163487299 19:17595710-17595732 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1163900214 19:20094053-20094075 TGGCCCAGTGGCCAGATTTCTGG + Intronic
1163907193 19:20157814-20157836 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1163944443 19:20522509-20522531 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1164080817 19:21860083-21860105 TAGCCCAGTGGCCAGATTTCTGG - Intergenic
1164152981 19:22570522-22570544 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1164258772 19:23551545-23551567 TGGCCCAGTGGCCGGATTTCTGG - Intronic
1164459221 19:28433291-28433313 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1164621365 19:29697684-29697706 TGTCCGGGTGTCCAGGTTTCTGG - Intergenic
1165496997 19:36158846-36158868 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1165510310 19:36262912-36262934 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1165835367 19:38751892-38751914 TGGCCTGGTGGCCAGATTTCTGG - Intronic
1166498930 19:43326931-43326953 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1167099466 19:47395328-47395350 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1167901109 19:52623030-52623052 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1167901603 19:52626452-52626474 TTGCCTGGTTGGCAAATTTCTGG - Intronic
1167902159 19:52630053-52630075 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1168227978 19:55010212-55010234 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1168248150 19:55124822-55124844 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1168250178 19:55137461-55137483 GGGGCTGGGGGCCAGACTTCTGG - Intronic
1168250250 19:55137675-55137697 GGGGCTGGGGGCCAGACTTCTGG - Intronic
925433848 2:3819332-3819354 TGGCCCAGTGGCCAGATATCCGG + Intronic
925828811 2:7876090-7876112 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
926373203 2:12201294-12201316 TGGCCTGGTGTTCACATTTGAGG + Intergenic
926407778 2:12572038-12572060 TGGCCTGTTGGTCAGATTTCTGG - Intergenic
926413598 2:12628783-12628805 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
926464083 2:13167419-13167441 TGGCCCAGTGGCCAGATTTGCGG + Intergenic
926790054 2:16561709-16561731 TGCCCTGTGGGCTAGATTTCAGG + Intronic
927134168 2:20084597-20084619 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
927480708 2:23451753-23451775 AGGCCTGTGGGCCAGTTTTCTGG - Intronic
927694298 2:25229924-25229946 TGGCCTGGTGGCCAATTATCGGG + Exonic
928770185 2:34696134-34696156 TGGCCCGGTGGTCAGATTTCTGG - Intergenic
928827647 2:35440526-35440548 TGGCCTGGTGGCCAGACTTCTGG + Intergenic
928857178 2:35815362-35815384 TGGCCTGGTGGCCAGACTTCTGG - Intergenic
928928572 2:36601317-36601339 TGGCCTGGTGGCCAGATTTCTGG - Intronic
929684517 2:44022472-44022494 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
929793057 2:45037864-45037886 TGGCTTGGTGGCCAGATTTTTGG + Intergenic
930487356 2:52025542-52025564 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
930955106 2:57195248-57195270 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
931026384 2:58116844-58116866 TGGCCTGGTGGCCAGATTTCTGG + Intronic
931042623 2:58315978-58316000 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
931236948 2:60419893-60419915 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
931608915 2:64078598-64078620 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
931625787 2:64254810-64254832 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
931850432 2:66246213-66246235 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
931948265 2:67333879-67333901 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
932358810 2:71088472-71088494 TGGCCTGGTGGCCACATTTCTGG + Intergenic
932367637 2:71163112-71163134 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
932854202 2:75217221-75217243 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
933013099 2:77090658-77090680 TGGCCTGGTGGTCAGATTTCTGG - Intronic
933079278 2:77967391-77967413 TTGCTTGGTGGTCAGATTTCTGG - Intergenic
933137944 2:78760180-78760202 TTGCCCAGTGGCCAGATTTCCGG - Intergenic
933163740 2:79053669-79053691 TGGCCTGGCTGCCAGATTTCTGG - Intergenic
933179760 2:79215247-79215269 TGGCCTGGTTGCCAGATTTCTGG + Intronic
933329510 2:80877895-80877917 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
933552385 2:83792338-83792360 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
935507872 2:103929891-103929913 TGGCTTGGTGGACAGACTGCTGG + Intergenic
936771479 2:115919128-115919150 TGGCCTGGATGCCACATATCAGG + Intergenic
936794284 2:116187697-116187719 TGGCCTGGTGGCCAGATTTCCGG + Intergenic
936883342 2:117281023-117281045 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
938292191 2:130156188-130156210 TGGCCTGGAGCCCAGATACCAGG + Intronic
938464360 2:131516781-131516803 TGGCCTGGAGCCCAGATACCAGG - Intergenic
939083129 2:137686372-137686394 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
939307421 2:140428421-140428443 TGGCCTGGTGGCCAGATTTCTGG - Intronic
940182949 2:150955321-150955343 TGACCCAGTGGCCAGATTTTTGG - Intergenic
940530196 2:154869603-154869625 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
940675795 2:156723497-156723519 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
941340408 2:164298137-164298159 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
941353394 2:164461392-164461414 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
941456178 2:165713924-165713946 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
941935882 2:170981067-170981089 TGACCTGGTGGCCAGATTTCTGG + Intergenic
942097094 2:172544020-172544042 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
942721837 2:178961898-178961920 TGGCCAGGTGCCCAGATATCAGG + Intronic
942730283 2:179055184-179055206 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
942788577 2:179731856-179731878 GGGCCTGGTGTGCACATTTCCGG - Intronic
943061580 2:183046168-183046190 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
943412923 2:187563907-187563929 TGGCCTGGTGGCCAGATTTCTGG + Intronic
943421576 2:187673906-187673928 TGCCCTGGTGGTCAGATTTCTGG + Intergenic
943450133 2:188035490-188035512 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
943461184 2:188172633-188172655 TGGCCTGGTAGCCAGATTTCTGG + Intergenic
943806659 2:192132705-192132727 TGCCCTGGTGGTCAGATTTCTGG - Intronic
943951280 2:194134307-194134329 TGGTCTGGTGGCCAGATTTCTGG + Intergenic
944876123 2:203965345-203965367 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
945173468 2:207019529-207019551 CGGCCCAGTGGCCAGATTTCCGG - Intergenic
945301474 2:208219665-208219687 TGGCCCAGGGGCCAGATTTCCGG + Intergenic
945361658 2:208901522-208901544 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
945376109 2:209080353-209080375 TGGCCTGGTGACCAGATTTCTGG - Intergenic
945394311 2:209301505-209301527 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
945554696 2:211263750-211263772 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
945858129 2:215091870-215091892 TGGCCCAGTGGCCAGATTTCCGG - Intronic
945938328 2:215924653-215924675 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
946215023 2:218177460-218177482 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
946781036 2:223193269-223193291 TGGCCTGGTGGCCAGATTTCTGG + Intronic
946886506 2:224227572-224227594 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
946893282 2:224298957-224298979 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
947702990 2:232250802-232250824 AGGCCTGGCGACCAGAATTCTGG - Intronic
948390693 2:237609237-237609259 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1168943270 20:1731171-1731193 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1169944881 20:10978076-10978098 AGGCCAGGTAGCCAGATCTCAGG - Intergenic
1170068857 20:12343704-12343726 TGGCCCAATGGCCAGATTTCTGG + Intergenic
1170106242 20:12756154-12756176 TGGCCCAATGGCCAGATTTCTGG - Intergenic
1170165750 20:13359243-13359265 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1170598124 20:17820760-17820782 TGTGCTGGTAGCCAGCTTTCTGG + Intergenic
1170680426 20:18521026-18521048 TGGTCCAGTGGCCAGATTTCCGG + Intronic
1170820693 20:19754574-19754596 TGCCCTGGTGGTCAGATTTCTGG + Intergenic
1172828680 20:37812936-37812958 TGGCTTGGGGGCCACATTCCTGG - Intronic
1172932463 20:38596145-38596167 TGGCCCAGTGGCCGGATTTCTGG + Intergenic
1173101922 20:40095630-40095652 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1173118879 20:40271340-40271362 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1173763767 20:45587625-45587647 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1173781733 20:45762075-45762097 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1176281997 20:64318593-64318615 TGGCATTGTGGCCATATCTCTGG - Intergenic
1177031163 21:15983220-15983242 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1177100632 21:16894458-16894480 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1177102682 21:16916270-16916292 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1178001209 21:28163496-28163518 TGGCCTAGTGGCCAGATTTCTGG - Intergenic
1178244069 21:30935442-30935464 TGGAGTGGTGGCCACACTTCAGG + Intergenic
1179015273 21:37590439-37590461 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1179387566 21:40957232-40957254 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1179650356 21:42804455-42804477 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1180560952 22:16613911-16613933 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1182113959 22:27744265-27744287 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1182732285 22:32505059-32505081 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1182889622 22:33806365-33806387 TGCCCTGGAGGCCAGACTTTTGG - Intronic
1183635661 22:39060944-39060966 TGCCCCAGTGGCCAGATTTCTGG + Intronic
1184465592 22:44667611-44667633 CTTCCTGGTGACCAGATTTCAGG - Intergenic
1184764527 22:46564550-46564572 TGGCCTGGAGGCCAGCTGTCTGG + Intergenic
1184992549 22:48180518-48180540 TGGCATGGGGGGCAGAATTCAGG + Intergenic
1185146827 22:49141688-49141710 TGGCCTGATGCCCAGGCTTCTGG - Intergenic
949162085 3:894097-894119 TGGCCTGGTGGCCAGATTTCCGG + Intergenic
949190388 3:1243240-1243262 TGGCCTGGTGGCCAGATTTCTGG + Intronic
949827450 3:8179298-8179320 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
950926503 3:16746599-16746621 TGGCCTGGGGGCCAGATTTCTGG - Intergenic
951253898 3:20427001-20427023 AGGTGTGGTGGCCATATTTCTGG + Intergenic
951298803 3:20970940-20970962 TGGCCTTGTGGCCAGATTTCTGG + Intergenic
951332319 3:21381991-21382013 TGGCCTTGTGGCCAGATTTCTGG + Intergenic
951762786 3:26163798-26163820 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
951837979 3:27003439-27003461 TGTCCTGTTGCCCAGACTTCAGG - Intergenic
951888970 3:27551556-27551578 TGGCACAGTGGCCAGATCTCTGG + Intergenic
952216576 3:31284082-31284104 TGGTCTGGAGGACAAATTTCTGG + Intergenic
952343553 3:32464838-32464860 TGGCCTGGTGGCCAGATTTCTGG + Intronic
952663447 3:35877753-35877775 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
952895207 3:38074092-38074114 TGGCCTAGTGGCCAGATTTCTGG + Intronic
952896049 3:38079708-38079730 TGGCCTGGTGGTCAGATTTCTGG + Intronic
953077126 3:39581228-39581250 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
953177200 3:40563261-40563283 TGGCCTGGTGGCCAGATTTCTGG - Intronic
953656558 3:44859112-44859134 TGGCCCAGTGGCCAGATTTATGG + Intronic
953825694 3:46249719-46249741 TGGCCTGGTGGTCAGATTTCTGG + Intronic
953841153 3:46391166-46391188 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
954161759 3:48727757-48727779 TGGCCCAGTGGCCAGATTTCTGG + Intronic
954969258 3:54637911-54637933 TGGCCCAGTGGCCAGATTTCCGG + Intronic
955253374 3:57305960-57305982 TGGCCCAGTGGCCAGATTTCTGG - Intronic
956548982 3:70438291-70438313 TGGTCTAGTGGCCAGATTTCTGG + Intergenic
956709225 3:72025270-72025292 TGGCCTTGTGGCCAGATTTCTGG - Intergenic
957059892 3:75473460-75473482 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
957155107 3:76536080-76536102 TGGCCCAGTGGCCAGTTTTGTGG + Intronic
957295244 3:78326084-78326106 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
957317303 3:78586575-78586597 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
957394374 3:79620095-79620117 TGGCCCAGTGGCCAGATTTCTGG - Intronic
957734857 3:84191230-84191252 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
957904839 3:86541810-86541832 TGGACCAGTGGCCAGATTTCTGG + Intergenic
957985696 3:87571638-87571660 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
958421964 3:93940082-93940104 TGGCCCAGTGGCCAGATTTCCGG - Intronic
959288344 3:104443347-104443369 TGGCTCAGTGGCCAGCTTTCCGG + Intergenic
959485768 3:106926158-106926180 TGGCTCGATGGCCAGATTTTTGG + Intergenic
959615141 3:108338841-108338863 TGTCCTGGAGGCAGGATTTCTGG + Intronic
959972258 3:112420993-112421015 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
960282868 3:115796934-115796956 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
960310108 3:116108747-116108769 TGGCCTGGTGGTCAGATTTCTGG + Intronic
961164754 3:124755981-124756003 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
961711619 3:128832620-128832642 TGGCTCGGTGGCCAGATTTCTGG + Intergenic
961730593 3:128961987-128962009 TGGCCTGGTGGTCAGATTTCTGG - Intronic
961893708 3:130150568-130150590 TGGTCTGGTGGCCAGATTTCTGG + Intergenic
962205572 3:133431410-133431432 TGGCCTGGTGGTCAGATTTCTGG - Intronic
962660640 3:137597755-137597777 TAGCCTGGTGGCCAGATTTCTGG - Intergenic
963058631 3:141207245-141207267 TGGCCTGATGGCCAGATTTCTGG - Intergenic
963319754 3:143799564-143799586 TGGCCCAGTGGCCAGATTTCCGG - Intronic
963425226 3:145115261-145115283 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
963456655 3:145554604-145554626 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
963521631 3:146364334-146364356 TGGCCTGATGGCCAGATTTCTGG - Intergenic
963663351 3:148153932-148153954 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
963684339 3:148416629-148416651 TGGCCCGGTGGCCAGATTTCTGG - Intergenic
964067881 3:152599621-152599643 TGGCCTGGTGGCCAGATTTTTGG - Intergenic
964067904 3:152599724-152599746 TGGCCTGGTGGCCAGATTTTTGG - Intergenic
964125446 3:153230122-153230144 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
964300246 3:155278611-155278633 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
964906509 3:161725290-161725312 TGGTCTGGTGGTCAGATTTCTGG + Intergenic
964983641 3:162714683-162714705 TGGCACAGTGGCCAGATTTCTGG - Intergenic
964984863 3:162725952-162725974 TGGCCCGGTGGCCAGATTTCTGG + Intergenic
965262646 3:166504214-166504236 TGGCTTGGTGGCCAGATTTCTGG + Intergenic
965286726 3:166827532-166827554 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
965336335 3:167433496-167433518 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
965512868 3:169588463-169588485 TGACATGGTGGCCAGAATTCAGG + Intronic
965624875 3:170675951-170675973 TGGCCTGGTGTCCAGATTTCTGG + Intronic
965640033 3:170821387-170821409 TGGCCTGGTGTCCAGATTTCTGG + Intronic
965713417 3:171578695-171578717 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
965861962 3:173159337-173159359 TGGCCCGGTGGCCAGATTACTGG + Intergenic
966066848 3:175829995-175830017 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
966085437 3:176063616-176063638 TGGCATGGTGGCCAGATTTCTGG - Intergenic
966105079 3:176325052-176325074 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
966232841 3:177669268-177669290 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
966279312 3:178209813-178209835 TGGCCCAATGGCCAGATTTCTGG - Intergenic
966397661 3:179519143-179519165 TGACCCAGTGGCCATATTTCTGG - Intergenic
966398443 3:179524362-179524384 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
967005353 3:185377961-185377983 TGGCCCAGTGGCCAGATTTCCGG + Intronic
967152135 3:186660296-186660318 TGGCCTAGTGGCTAGATTTCTGG - Intronic
967244159 3:187469700-187469722 TGCCCTGGTGGCCAGATTTCTGG + Intergenic
967252350 3:187553668-187553690 TAGTCTGGTGGCCAAACTTCAGG - Intergenic
967270620 3:187729381-187729403 TGGGCTGGCAGTCAGATTTCTGG + Exonic
967496228 3:190146786-190146808 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
967643823 3:191898798-191898820 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
967658099 3:192074514-192074536 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
967740494 3:192997964-192997986 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
968993389 4:3929659-3929681 TGGCCTGGTAGTCAGATTTCTGG - Intergenic
969003805 4:4003645-4003667 TGGCCTGGTGGCCAGCTTTCTGG + Intergenic
969654093 4:8486211-8486233 TGGCCTGGTGGCCAGATTTCTGG + Intronic
969654605 4:8489224-8489246 TTGCCTGGTGGCCATGTTGCAGG - Intronic
969749062 4:9096540-9096562 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
969810122 4:9641180-9641202 TGGCCTGGTGGCCAGCTTTCTGG - Intergenic
969870756 4:10103185-10103207 TGGCCTGGAGGCCAGCATTGTGG + Intronic
970029226 4:11657162-11657184 TGGACCAGTGGCCAGATTTCCGG + Intergenic
970042097 4:11808554-11808576 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
970087554 4:12366043-12366065 TGGCCTGCTGGCCAGATTTCTGG - Intergenic
970256415 4:14173959-14173981 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
970532742 4:16999943-16999965 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
971123181 4:23725455-23725477 TGGCTTGGTGGTCAGATTTCTGG + Intergenic
971200143 4:24503288-24503310 TGGCTTGGTGGTCAGATTTCTGG - Intergenic
973751130 4:54022084-54022106 TGGCTCAGTGGCCAGATTTCTGG - Intronic
974173426 4:58294750-58294772 TGTCCCAGTGGCAAGATTTCTGG + Intergenic
974310423 4:60201104-60201126 TGGCCTGAAGGCCATATTCCTGG + Intergenic
974428390 4:61767721-61767743 TGGCCCAGTGGCCAGATTTCCGG + Intronic
975788918 4:77926367-77926389 AGGCCTGGCTGCCAGAGTTCTGG - Intronic
975865083 4:78717291-78717313 TGGCCTAGTGGCCAGATTTCCGG + Intergenic
975933882 4:79557410-79557432 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
976558577 4:86476868-86476890 TGGTCCAGTGGCCAGATTTCTGG - Intronic
976696544 4:87924146-87924168 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
976739949 4:88347180-88347202 GGGCCCAGTGGCCAGATTTCCGG + Intergenic
976884565 4:89968225-89968247 TGGCCCGGTGGCCAGATTTCTGG + Intergenic
977010324 4:91626368-91626390 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
977012917 4:91658055-91658077 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
977062503 4:92274923-92274945 TGGCCTGGTGATCAGATTTCTGG + Intergenic
977075198 4:92442394-92442416 TGGCCCGGTGGCCAGATTTCCGG + Intronic
977198424 4:94088057-94088079 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
977217149 4:94296648-94296670 TGGCCTAGTGGTCAGATTTCTGG + Intergenic
977446431 4:97138034-97138056 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
977797997 4:101191776-101191798 TGGACTGGTGGCCAAGTTTAAGG - Intronic
978001114 4:103557196-103557218 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
978031489 4:103943419-103943441 TGGCCTGGTGGACAGATTTCTGG - Intergenic
978438616 4:108711305-108711327 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
979054615 4:115979086-115979108 CGGCCTGGTGGCCAGATTTCTGG + Intergenic
979146625 4:117254378-117254400 CGGCCTGGTGGCCAGATTTCTGG - Intergenic
979379947 4:119996199-119996221 TGGCCCAGTGGCCAGATTTTTGG - Intergenic
979850304 4:125565069-125565091 TGGCCCATTGGCCAGATTTACGG + Intergenic
979895153 4:126148569-126148591 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
980003345 4:127514879-127514901 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
980111920 4:128644287-128644309 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
980284953 4:130769638-130769660 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
980388931 4:132120478-132120500 TGGCCTGGTGGCCATATTTCTGG - Intergenic
980472435 4:133267125-133267147 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
980491346 4:133532590-133532612 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
980527875 4:134014452-134014474 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
980575630 4:134681339-134681361 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
980611771 4:135170723-135170745 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
980903944 4:138930149-138930171 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
981040250 4:140215772-140215794 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
981482720 4:145254978-145255000 TGGCCCAGTGGCCAGATTTTTGG + Intergenic
981525215 4:145701378-145701400 TGGCCTGGTGGTCAGATTTCTGG - Intronic
981539731 4:145835023-145835045 TGGCCCAGTGGCCAGATTTCCGG - Intronic
982083962 4:151816035-151816057 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
982180476 4:152744765-152744787 TGGCCCAGTGGCCAGATTTCTGG + Intronic
982414189 4:155111894-155111916 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
982497102 4:156106899-156106921 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
982535453 4:156602560-156602582 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
982662079 4:158219220-158219242 TGGACTAGGGGCCAGATTCCTGG - Intronic
983023878 4:162711379-162711401 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
983055493 4:163095366-163095388 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
983345562 4:166522800-166522822 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
983414703 4:167439237-167439259 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
983452341 4:167925172-167925194 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
983659578 4:170118732-170118754 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
983707680 4:170679770-170679792 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
983805782 4:171989463-171989485 TGGCCCAGTGGCCAGATTTCCGG + Intronic
984099043 4:175464867-175464889 TGGCTTGGTGGTCAGATTTCTGG + Intergenic
984322194 4:178209400-178209422 TGGCCTGGTGGCCAAATTTCTGG - Intergenic
984393609 4:179168322-179168344 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
984411735 4:179405496-179405518 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
984437269 4:179722724-179722746 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
984700677 4:182816800-182816822 TGGCCTAGTGGCCAGATTTCCGG - Intergenic
985057390 4:186047630-186047652 TGGCCTGGTGGCCAGATTGTCGG + Intergenic
985079000 4:186245541-186245563 TGGCCCATTGGCCAGATTTCTGG + Intronic
985389862 4:189482896-189482918 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
985435727 4:189928127-189928149 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
985582360 5:705067-705089 TGGCTTGGTGGCCAGATTTTTGG - Intergenic
986193539 5:5517833-5517855 TGGCCTGGTGGTCAGATTTCGGG - Intergenic
986368974 5:7061743-7061765 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
986555037 5:9001978-9002000 TGGCTTGGTGGCCAGATTTCTGG + Intergenic
986905779 5:12492079-12492101 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
986919579 5:12665972-12665994 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
987047738 5:14123504-14123526 TGGGATGGTGGCCAGAAGTCTGG + Intergenic
987486844 5:18535953-18535975 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
987487508 5:18540587-18540609 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
987498116 5:18672291-18672313 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
987755836 5:22097122-22097144 TGGCCTGGTGGCCAGATTTCTGG - Intronic
988565921 5:32320166-32320188 TGGCCTGGCCCCCAGACTTCAGG + Intergenic
989615153 5:43331371-43331393 TGGCCCAGTGGCCAGATTTTTGG + Intergenic
989686929 5:44100089-44100111 TGGCCTGGAAGTCAGATATCTGG - Intergenic
991289486 5:65018956-65018978 TGGGCAGGGGGCCAGATGTCAGG - Intergenic
992394668 5:76359632-76359654 TGGCTTGGTGGCCAGATTTCCGG - Intergenic
992960836 5:81955536-81955558 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
993132554 5:83917530-83917552 AAGCCTGAAGGCCAGATTTCTGG + Intergenic
993192719 5:84700757-84700779 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
993836712 5:92826253-92826275 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
994126102 5:96170309-96170331 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
994375777 5:99014740-99014762 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
994556942 5:101317214-101317236 TGGCCTGGTGGCGAGATTTCTGG - Intergenic
994775689 5:104033895-104033917 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
994778940 5:104067620-104067642 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
994989558 5:106980658-106980680 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
995125153 5:108571889-108571911 TGGCCCAGCGGCCAGATTTCCGG + Intergenic
995296681 5:110532119-110532141 TGGCTTGGTGGCCAGATTTTTGG - Intronic
995899362 5:117049797-117049819 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
996203253 5:120701023-120701045 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
996574990 5:124970032-124970054 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
996912439 5:128670653-128670675 TGGCCTGGTGGCCAGATTTCTGG + Intronic
996917688 5:128731824-128731846 TGGCCCAGTGGCCAGATTTCTGG - Intronic
997746406 5:136303591-136303613 TGGCTCGGTGGCCAGATTTTTGG - Intronic
997769675 5:136543045-136543067 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
997770623 5:136549753-136549775 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
997772637 5:136568780-136568802 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
998693696 5:144614770-144614792 TGGTCCAGTGGCCAGATTTCCGG + Intergenic
998995397 5:147865553-147865575 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
998996392 5:147872405-147872427 TGGCCTGGTGGTCAGATTTCTGG + Intronic
999458724 5:151739682-151739704 TTGCCTGGTGGCCAGAGCCCGGG - Intergenic
999618863 5:153453142-153453164 TGGCCCAGTAGCCAGATTTCTGG + Intergenic
1000438591 5:161242245-161242267 TGGACTGGTGTCCAGATTTCTGG - Intergenic
1000439727 5:161250770-161250792 TGGCCTGGTGGCCAGCTTTCTGG - Intergenic
1000519400 5:162278809-162278831 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1000885313 5:166742523-166742545 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1000935636 5:167301320-167301342 TGGCCTGGTGGCCAGATTTCTGG + Intronic
1001063515 5:168515698-168515720 TGGCCAGAGGGCCATATTTCAGG - Intronic
1001331444 5:170765466-170765488 TGTCCTGGTGGTCAGATTTCTGG + Intronic
1002291280 5:178202704-178202726 TGGCGTGGTGGCCACGTTTCTGG + Intergenic
1002610955 5:180418158-180418180 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1003099744 6:3168150-3168172 TGGCCTAGTGGCCAGATTTCTGG - Intergenic
1003430160 6:6031215-6031237 TGGCCTGGTGGTCAGATTTCCGG + Intergenic
1004106273 6:12669655-12669677 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1004283515 6:14300384-14300406 TGGCCCGGTGGCCAGATTTCCGG + Intergenic
1004495034 6:16155226-16155248 TGGTCTTTTGGCCAGATTCCCGG - Intergenic
1004507990 6:16262425-16262447 TGGCCTGGTGGCCAGATTTCTGG + Intronic
1004575228 6:16888234-16888256 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1004768568 6:18757498-18757520 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1004837007 6:19541182-19541204 TGGGGTGGTGGCCAGATTTCTGG - Intergenic
1005014652 6:21364940-21364962 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1005595730 6:27377288-27377310 TGGCCTTGTGGTCGGAGTTCTGG - Intronic
1005786566 6:29250639-29250661 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1006324860 6:33346110-33346132 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1007106338 6:39285628-39285650 TGGCCTGGAGGCCATGTTTGGGG + Intergenic
1007278629 6:40693699-40693721 GGGGCAGGTTGCCAGATTTCAGG - Intergenic
1007300979 6:40867639-40867661 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1007421017 6:41719819-41719841 TGGCCTGAGGGCCTGAGTTCTGG - Intronic
1007754851 6:44092757-44092779 TGGCCTGGTGGCATGATTGGAGG - Intergenic
1009269828 6:61602380-61602402 TGGCCCAGCAGCCAGATTTCTGG - Intergenic
1009359360 6:62793782-62793804 TGGTCTGGTGGCCAGATTTCTGG - Intergenic
1009464341 6:63952184-63952206 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1010071718 6:71751980-71752002 TGGCCCAGTGGTCAGATTTCTGG + Intergenic
1010586690 6:77663988-77664010 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1010826907 6:80485870-80485892 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1010829683 6:80513738-80513760 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1010841307 6:80651230-80651252 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1010894540 6:81348570-81348592 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1011367893 6:86601803-86601825 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1011770936 6:90673645-90673667 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1012675105 6:102104234-102104256 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1012689581 6:102295203-102295225 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1013407883 6:109859188-109859210 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1013843673 6:114425756-114425778 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1013891711 6:115034158-115034180 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1014115334 6:117663118-117663140 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1014454865 6:121623872-121623894 TGGCCCAGAGGCCAGATTTCCGG + Intergenic
1014555854 6:122842106-122842128 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1014612094 6:123558919-123558941 TGGCCCAGTGGCCGGATTTCCGG - Intronic
1014614667 6:123585721-123585743 TGGCCTGGTGGCCAGATTTCTGG + Intronic
1014718902 6:124894314-124894336 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1014793984 6:125705294-125705316 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1014891549 6:126851031-126851053 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1015165227 6:130194621-130194643 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1015266743 6:131297733-131297755 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1015269662 6:131325680-131325702 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1015271379 6:131341158-131341180 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1015278161 6:131405090-131405112 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1015323836 6:131903963-131903985 TGGCCCAGTGGCCAGATTGCCGG - Intergenic
1015588907 6:134803980-134804002 GGGCCTGCTTGCCAGATTTGAGG + Intergenic
1015801370 6:137064758-137064780 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1016114136 6:140260843-140260865 TGGCCTGGTGGACAGATTTCTGG + Intergenic
1016204542 6:141455107-141455129 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1016248868 6:142018085-142018107 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1016518814 6:144925449-144925471 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1016650286 6:146453848-146453870 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1016853275 6:148642077-148642099 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1017389508 6:153923762-153923784 TGGCCCGGTGGCCAGATTTCCGG - Intergenic
1017951062 6:159135684-159135706 TGGCCTGGTGGAGAGAATGCAGG - Intergenic
1018077604 6:160230772-160230794 TGGCCCAGAGGCCAGATTGCTGG - Intronic
1018084490 6:160290004-160290026 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1018495397 6:164342166-164342188 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1018521463 6:164655584-164655606 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1018878334 6:167847213-167847235 TGGCCTGTTGCCCAGACCTCAGG + Intronic
1019161974 6:170075147-170075169 TGGCCCGGCCGCCAGAGTTCTGG - Intergenic
1020323939 7:6960100-6960122 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1020532707 7:9356852-9356874 TGGCCTAGTGGCCAGATTTCCGG + Intergenic
1020541135 7:9461988-9462010 TGGCCTGGTAGCCAGTTTTCTGG + Intergenic
1020794221 7:12661844-12661866 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1021172677 7:17416120-17416142 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1021393630 7:20122880-20122902 TGGCCCGGTGGCCAGATTTCTGG - Intergenic
1021429855 7:20547726-20547748 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1021977890 7:26027620-26027642 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1022372878 7:29787124-29787146 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1022447409 7:30481509-30481531 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1022710041 7:32841336-32841358 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1022785562 7:33634049-33634071 AGGCGGGGTGGCCAGATTGCTGG - Intergenic
1022854704 7:34303325-34303347 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1023269599 7:38447584-38447606 TGCTCTGGAGGCTAGATTTCTGG - Intronic
1023698881 7:42874040-42874062 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1023841515 7:44101106-44101128 TAGCCTGCTGGCCAGATCCCAGG + Intergenic
1023848496 7:44137645-44137667 TGGGCTGGTGGCCTGCTTTCAGG + Intergenic
1025170125 7:56748915-56748937 TCACCTTTTGGCCAGATTTCAGG - Intergenic
1025635691 7:63317672-63317694 TGGCCTGGTGGGCAGCTGCCGGG - Intergenic
1025647005 7:63430508-63430530 TGGCCTGGTGGGCAGCTGCCGGG + Intergenic
1025701760 7:63826803-63826825 TCACCTTTTGGCCAGATTTCAGG + Intergenic
1026171164 7:67955155-67955177 TCACCTTTTGGCCAGATTTCAGG + Intergenic
1027157893 7:75781430-75781452 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1027851953 7:83461942-83461964 TGGCCCAGTGGCCAGATTTCCGG - Intronic
1028589903 7:92483221-92483243 TGGCCCAATGGTCAGATTTCCGG + Intergenic
1028670516 7:93396208-93396230 TGGCCCAGTGGTCAGATTTCTGG - Intergenic
1028690185 7:93642138-93642160 TAGCCCAGTGGCCAGATTTCTGG - Intronic
1028951819 7:96644745-96644767 TGGGCTGGTGCCCAACTTTCAGG - Intronic
1029500219 7:100924447-100924469 TGGCTCAGTGGCCAGATTTCTGG - Intergenic
1030441682 7:109595459-109595481 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1030445776 7:109645551-109645573 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1030642426 7:112021566-112021588 TCGGCTGGTGGCCAGATTCATGG - Intronic
1030751494 7:113237011-113237033 TGGACTGGTGGTCAGATTTCTGG + Intergenic
1031004676 7:116457761-116457783 TGGCCCAGTGGCCAGATTTCCGG - Intronic
1031296622 7:120011167-120011189 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1031327629 7:120421891-120421913 TGGACTAGTGGCCACTTTTCAGG + Intronic
1031422449 7:121567412-121567434 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1031525597 7:122819198-122819220 TGGCCCAGTGGCCAAATATCTGG - Intronic
1031685852 7:124731316-124731338 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1031727924 7:125262335-125262357 TGGCCCCGTGGCCAGATTTCTGG + Intergenic
1031776329 7:125912266-125912288 TGGCCCAGTGGTCAGATTTCCGG - Intergenic
1031777351 7:125919891-125919913 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1032536812 7:132671398-132671420 GAGGCTGATGGCCAGATTTCAGG + Intronic
1033084724 7:138331306-138331328 CGGCCCAGTGGCCAGATTTCTGG - Intergenic
1033211525 7:139463569-139463591 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1033465027 7:141582218-141582240 TGGCCCAGTGACCAGATTTCTGG + Intronic
1033625595 7:143107099-143107121 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1033675943 7:143540655-143540677 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1033909462 7:146246812-146246834 TGGCCTGGTGGCCAGATTTCTGG + Intronic
1034334132 7:150309631-150309653 TGGTCTAGTGGCCAGTTTTGCGG - Intronic
1035880658 8:3241649-3241671 TGGCCTGGTGGCCAGATTTCTGG + Intronic
1036070917 8:5440074-5440096 TGGCCTAGTGGCCAGATTTCTGG + Intergenic
1036372136 8:8170884-8170906 TGGTCTGGTGGCCAGATTTCTGG - Intergenic
1036472323 8:9062868-9062890 TGGCCCAGTGGCCAGATTTCTGG + Intronic
1036639499 8:10573546-10573568 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1036878765 8:12494757-12494779 TGGTCTGGTGGCCAGATTTCTGG + Intergenic
1037760451 8:21738261-21738283 TGGCCTGGTGGCCAGCTGGCTGG - Intronic
1037784139 8:21892658-21892680 AGTCCTGGGGGCCAGGTTTCTGG + Intergenic
1038879770 8:31595788-31595810 TGGCCAGGTGGCAATTTTTCAGG - Intergenic
1040610508 8:48977830-48977852 TGCCCTGGGGGCCGGGTTTCGGG - Intergenic
1040648029 8:49421776-49421798 TGGCCCAGTGGCCAGATTTTTGG - Intergenic
1041651836 8:60309933-60309955 TGGCCCAGTGGCCAGACTTCTGG + Intergenic
1042453565 8:68975449-68975471 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1042609021 8:70577344-70577366 TGGCCTGGCCCCCAGGTTTCAGG - Intronic
1042707377 8:71677189-71677211 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1043597448 8:81901970-81901992 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1043598851 8:81915724-81915746 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1043717891 8:83508574-83508596 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1043720912 8:83546247-83546269 TGGCCTAGTGGCCAGATTTCTGG - Intergenic
1044148511 8:88745648-88745670 TGGCCCAGTGGGCAGATTTCTGG + Intergenic
1044258610 8:90093637-90093659 TGGCCTGGTGGTCAGATTTCTGG + Intronic
1044417089 8:91950245-91950267 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1044921999 8:97177352-97177374 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1044925166 8:97203196-97203218 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1045197529 8:99946147-99946169 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1045644787 8:104288211-104288233 TGGCCCAGTGGCCGGATTTCCGG - Intergenic
1046294124 8:112198100-112198122 TGGCTTGGTGGCCAGATTTTTGG - Intergenic
1046386335 8:113512946-113512968 TGGCCCAGTGGCCCGATTTCCGG + Intergenic
1046440020 8:114243614-114243636 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1046512091 8:115214503-115214525 TGGCCCAGGGGCCCGATTTCCGG - Intergenic
1046559286 8:115816885-115816907 TGCCTTGGTGGTCAGATTTCTGG - Intergenic
1047699354 8:127434005-127434027 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1047829539 8:128615341-128615363 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1047856380 8:128916696-128916718 TGGCCTGGTGGCCACATTTCTGG - Intergenic
1048097617 8:131312482-131312504 TGGCCCAGTGGTCAGATTTCTGG - Intergenic
1048135477 8:131742998-131743020 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1048143779 8:131821462-131821484 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1048585415 8:135770574-135770596 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1048728414 8:137411708-137411730 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1048764230 8:137828249-137828271 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1049246823 8:141567331-141567353 TGGCCAGGGGGCCAGAGTGCAGG + Intergenic
1049868811 8:144957692-144957714 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1050117608 9:2277844-2277866 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1050258101 9:3814584-3814606 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1050896081 9:10887044-10887066 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1051052632 9:12950599-12950621 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1051642192 9:19233797-19233819 TGGCCAGGTGGCCTGATGTCAGG + Intronic
1051849279 9:21489134-21489156 TGGCCTGGTGGCCACATTTCTGG + Intergenic
1051953400 9:22662000-22662022 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1052653341 9:31328692-31328714 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1052720634 9:32167944-32167966 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1053058038 9:35005766-35005788 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1053465906 9:38308448-38308470 TGCCTTGTTGGCCAAATTTCTGG - Intergenic
1054702704 9:68429720-68429742 TGGCCTGTTCTCCAGATGTCAGG - Intronic
1054807482 9:69408185-69408207 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1055233069 9:74087941-74087963 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1055347712 9:75355213-75355235 TGGTCTGGTGGCCAGATTTCTGG + Intergenic
1055626728 9:78183085-78183107 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1055881753 9:81011285-81011307 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1055927942 9:81530063-81530085 TTGCCTGGAGGCCAGCTTCCAGG + Intergenic
1056044733 9:82704144-82704166 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1056061164 9:82886035-82886057 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1056323893 9:85460924-85460946 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1056522452 9:87413204-87413226 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1056882986 9:90414853-90414875 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1057234854 9:93349883-93349905 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1057377997 9:94542105-94542127 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1057684008 9:97217121-97217143 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1057812574 9:98269243-98269265 TGGCCTAGTGGCCAGATTTCCGG + Intergenic
1058026200 9:100144126-100144148 TGTCCCGGTGGCCAGATGTCCGG + Intronic
1058612407 9:106790475-106790497 TGGCCTAGTGGCTAGATTTCTGG - Intergenic
1059546152 9:115178052-115178074 TGGCCTAGTGGCTAGATTTCCGG + Intronic
1059574626 9:115475637-115475659 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1059606701 9:115842637-115842659 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1059863481 9:118489106-118489128 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1060226201 9:121792602-121792624 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1060318462 9:122534066-122534088 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1060737877 9:126078060-126078082 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1061813975 9:133182181-133182203 GGGCCTGGTGGCCAGATGGAAGG + Intergenic
1061933887 9:133846852-133846874 TGGCCTGGTGACCCGATCACTGG - Intronic
1185519062 X:724741-724763 TGGTCAGGTGGTCAGATCTCAGG - Intergenic
1185858423 X:3556556-3556578 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1185960684 X:4543916-4543938 TGGCTTGGTGGCCAGATTTCTGG + Intergenic
1185991067 X:4893870-4893892 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1186784074 X:12942101-12942123 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1187086516 X:16048119-16048141 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1187099951 X:16182589-16182611 TGGCCTAGTGGCCAGATTTCTGG + Intergenic
1188200962 X:27292575-27292597 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1188301051 X:28505857-28505879 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1188333012 X:28896022-28896044 TGGCCTGGTGGCCAGATTTCCGG + Intronic
1188431031 X:30105622-30105644 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1188463369 X:30452526-30452548 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1188552659 X:31379783-31379805 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1189031808 X:37459200-37459222 TGGCCCAGTGGCCAGATTTCTGG + Intronic
1191014187 X:55791738-55791760 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1191761278 X:64651188-64651210 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1191825559 X:65361996-65362018 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1192706150 X:73529944-73529966 TCGCCCAGTGGCCAGATTTCTGG - Intergenic
1192914125 X:75635697-75635719 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1193885934 X:86984084-86984106 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1193941505 X:87684168-87684190 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1194186243 X:90776749-90776771 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1194293617 X:92103667-92103689 TGGCCCAGTGGCCAGATTTCCGG + Intronic
1194308535 X:92276490-92276512 TGGCCTGGTGGTCAGATTACTGG + Intronic
1194351296 X:92826770-92826792 TGGCCCAGTGTCCAGATTTCTGG - Intergenic
1194367112 X:93025212-93025234 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1194502975 X:94702250-94702272 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1194648222 X:96483876-96483898 TGACCTGCTGACCAGATTTTTGG - Intergenic
1194660695 X:96626305-96626327 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1194822761 X:98527702-98527724 TGGCCCGGTGGCCAGATTTCCGG + Intergenic
1195016945 X:100789851-100789873 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1195291148 X:103432960-103432982 TGGCCCAATGGCCAGATTTCTGG + Intergenic
1195753359 X:108178422-108178444 TGGCCTCATGCCCAGTTTTCAGG - Intronic
1195841493 X:109180700-109180722 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1195908672 X:109868646-109868668 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1196073088 X:111546196-111546218 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1196165550 X:112532895-112532917 TGGCCCTGTGGCCAGATTTCTGG - Intergenic
1196220977 X:113112149-113112171 TGGCCCAGTGGTCAGATTTCCGG + Intergenic
1196227210 X:113180231-113180253 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1196300018 X:114042262-114042284 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1196330831 X:114469042-114469064 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1196341712 X:114604733-114604755 TGGCCTGGTGGTCAGATTTCTGG + Intronic
1196469911 X:116012952-116012974 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1196496873 X:116333102-116333124 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1196572504 X:117281438-117281460 TGGCCTGGTGGTCAGATTTCTGG - Intergenic
1196585131 X:117419942-117419964 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1196773849 X:119321196-119321218 TGGCTTGGTGGTCAGATTTCTGG + Intergenic
1196992677 X:121346420-121346442 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1197064922 X:122224314-122224336 TGGCCTGGTGGCCACATTTCTGG - Intergenic
1197352051 X:125392276-125392298 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1197470970 X:126865382-126865404 TGGCCCAGTGGCCAGATTGCTGG - Intergenic
1197499728 X:127228879-127228901 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1197793643 X:130279314-130279336 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1197933091 X:131714351-131714373 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1198053160 X:132968465-132968487 TGGCCTGGAGGTCAGGTCTCAGG + Intergenic
1198598454 X:138261099-138261121 TGGCCTAGTGGCCAGATTTCAGG - Intergenic
1198599394 X:138267740-138267762 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1198751689 X:139942459-139942481 TGGGCTGGAAGCCAGATTGCAGG + Intronic
1198965931 X:142228829-142228851 TAGCCCAGTGGCCAGATTTCTGG - Intergenic
1198983750 X:142426996-142427018 TGGCCTGGTGGCCAGATTTCTGG + Intergenic
1200532833 Y:4358828-4358850 TGGCCTGGTGGTCAGATTTCTGG + Intergenic
1200611136 Y:5328213-5328235 TGGCCCAGTGGCCAGATTTCTGG + Intronic
1200659621 Y:5943460-5943482 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1200675325 Y:6141468-6141490 TGGCCTGGTGGCCAGATTTCTGG - Intergenic
1201307498 Y:12563359-12563381 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1201473501 Y:14357827-14357849 TGGCTCTGTGGACAGATTTCTGG + Intergenic
1201581396 Y:15514654-15514676 TGGCATGGTGGCCAGATTTCTGG - Intergenic
1201937133 Y:19421246-19421268 TGGCCTAGTGGCCAGATTTCTGG - Intergenic
1202076520 Y:21042512-21042534 TGGCCCAGTGACCAGATTTCTGG + Intergenic