ID: 1173763770

View in Genome Browser
Species Human (GRCh38)
Location 20:45587645-45587667
Sequence TGGCACTTGTAGCAAGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 845
Summary {0: 278, 1: 142, 2: 126, 3: 107, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173763768_1173763770 -6 Left 1173763768 20:45587628-45587650 CCTGGTGGCCAGATTTCTGGCAC 0: 157
1: 314
2: 214
3: 192
4: 217
Right 1173763770 20:45587645-45587667 TGGCACTTGTAGCAAGCTCCTGG 0: 278
1: 142
2: 126
3: 107
4: 192
1173763766_1173763770 0 Left 1173763766 20:45587622-45587644 CCTTGGCCTGGTGGCCAGATTTC 0: 158
1: 207
2: 446
3: 128
4: 205
Right 1173763770 20:45587645-45587667 TGGCACTTGTAGCAAGCTCCTGG 0: 278
1: 142
2: 126
3: 107
4: 192
1173763763_1173763770 16 Left 1173763763 20:45587606-45587628 CCTGGGCTACGGCATTCCTTGGC No data
Right 1173763770 20:45587645-45587667 TGGCACTTGTAGCAAGCTCCTGG 0: 278
1: 142
2: 126
3: 107
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173763770 Original CRISPR TGGCACTTGTAGCAAGCTCC TGG Intergenic
900395451 1:2451513-2451535 TGGCCCTTGGAGCCAGTTCCTGG - Intronic
900722534 1:4186683-4186705 TGGCACTTGCAGCCAGCTCCTGG + Intergenic
900840793 1:5047107-5047129 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
900847480 1:5115382-5115404 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
901056913 1:6452642-6452664 TCGCATTTCTAGCCAGCTCCTGG + Intronic
901686662 1:10947198-10947220 TGGGACTTGAACCTAGCTCCTGG + Intronic
901757981 1:11452995-11453017 TGTCACCTGTAGCAAGGCCCAGG + Intergenic
902050922 1:13563140-13563162 CGGCACTTGAAGCAAGATCCTGG - Intergenic
902984458 1:20147176-20147198 TGGCATTTCTAACAAGTTCCTGG - Intronic
903396020 1:23002398-23002420 TGGCACTTGAAGCAAGATCCTGG + Intergenic
903681422 1:25099916-25099938 TTGCACTTCTGACAAGCTCCCGG + Intergenic
904393965 1:30205652-30205674 TGGCACTTGAAGCAAAATCCTGG - Intergenic
904996475 1:34635408-34635430 CGGCACGTGTAGCAAGCTCCTGG + Intergenic
905060514 1:35135781-35135803 TGGCACTTCTAGCAAGCTCCTGG + Intergenic
905499786 1:38427341-38427363 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
906080925 1:43087768-43087790 CGGCACTTGTAGCAAGCTCCTGG - Intergenic
906378729 1:45317896-45317918 CAGCACTTGAAGCAAGATCCTGG - Intergenic
906744516 1:48212440-48212462 TAGCACTTGTAGCAAGCTCCTGG + Intergenic
907292639 1:53426556-53426578 TGGCACTTGTAGCAAACTCCTGG - Intergenic
907293609 1:53434506-53434528 TGGCACTTGAAGCAAGATCCTGG - Intergenic
907441183 1:54479431-54479453 TGGCACTGGGAGCAAGCACTGGG + Intergenic
907503561 1:54901311-54901333 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
907521265 1:55024860-55024882 TGGCACTTGTAGCAAACTCCTGG - Intergenic
908852410 1:68388525-68388547 CGGCACATGTAGCAAGCTCCTGG - Intergenic
909035480 1:70590564-70590586 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
909223646 1:72991234-72991256 CAGCACATGTAGCAAGCTCCTGG + Intergenic
909374168 1:74921176-74921198 TGGCACTTGAAGCAAGATCCTGG - Intergenic
909551013 1:76898224-76898246 CAGCACTTGTAGCAAGCTCCTGG + Intronic
909776686 1:79492013-79492035 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
909788262 1:79642175-79642197 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
910049387 1:82957576-82957598 CGGCACTTGTAGCAAGCTCCTGG - Intergenic
910144125 1:84058673-84058695 TGGCACTTGTAGAGAGCTCCTGG + Intergenic
911071080 1:93832320-93832342 CGGCACTTGAAGCAAGATCCTGG - Intronic
911147981 1:94570309-94570331 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
911759776 1:101601485-101601507 CGGCACTTGTAGCAAGCTCCTGG + Intergenic
911966934 1:104382447-104382469 CAGCACTTGAAGCAAGATCCTGG - Intergenic
912296481 1:108475211-108475233 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
912813571 1:112811699-112811721 CGGCACTTGTAGCAAGCTCCTGG - Intergenic
912815303 1:112823918-112823940 TAGCACTCATAGCAAGCTCCTGG + Intergenic
912987512 1:114449431-114449453 TGGCACTTGTGGCACTCTCTTGG + Intronic
913001881 1:114588802-114588824 AGGCACTTGTCTCAAACTCCTGG + Intronic
913245139 1:116864392-116864414 TGGCACTTGAAGCAAGATCCTGG - Intergenic
916328865 1:163593281-163593303 CAGCACTTGAAGCAAGATCCTGG - Intergenic
917196095 1:172467231-172467253 TGGCATTTGTAGCAATCCACAGG - Intronic
917749659 1:178042237-178042259 TGGCACTTGAAGCAAGATCCTGG - Intergenic
918347123 1:183615907-183615929 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
918567665 1:185951750-185951772 CGGCACGTGTAGCAAGCTCCTGG + Intronic
918714399 1:187768947-187768969 CGGCACGTGTAGCAAGCTCCTGG + Intergenic
919476405 1:198037053-198037075 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
919587320 1:199455004-199455026 TGTCTCTTGTAGCAGGCTGCAGG + Intergenic
920829407 1:209451195-209451217 CCGCACATGTAGCAAGCTCCTGG - Intergenic
921509263 1:216010266-216010288 TGGCACTTGTAGCAAGCTCCTGG - Intronic
921520136 1:216147807-216147829 CAGCACGTGTAGCAAGCTCCTGG - Intronic
921732967 1:218597243-218597265 CGGCACGTGTAGCAAGCTCCTGG + Intergenic
921920167 1:220659614-220659636 TGTCCATTGTAGAAAGCTCCTGG - Intronic
922048420 1:221968215-221968237 TGGCACTTGTAGCAAACTCCTGG - Intergenic
922154062 1:223027857-223027879 CGGCATGTGTAGCAAGCTCCTGG + Intergenic
922363539 1:224843907-224843929 TGGCACTTGAAGCAAGCTCCTGG + Intergenic
922598980 1:226835527-226835549 CAGCACTTGAAGCAAGATCCTGG - Intergenic
922877089 1:228948495-228948517 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
923075212 1:230603489-230603511 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
923214187 1:231833661-231833683 TGGCACTTGTAGCAAGCTCCTGG + Intronic
923244759 1:232120438-232120460 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
923770730 1:236935705-236935727 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
923962791 1:239103630-239103652 TGGCACTTGTAGCAAGCCTCTGG - Intergenic
924896174 1:248339681-248339703 CGGCGCTTATAGCAAGCTCCTGG + Intergenic
1063106402 10:2996432-2996454 CACCACTTGTAGCAAGCTCCTGG + Intergenic
1063363174 10:5473371-5473393 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1063421505 10:5916128-5916150 TGGCACTTGAAGCTACCTCCTGG + Intronic
1064663806 10:17630296-17630318 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1064881426 10:20059031-20059053 CTGCATTTCTAGCAAGCTCCTGG - Intronic
1064886988 10:20122611-20122633 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1065175488 10:23071222-23071244 TTGCACTGTTAACAAGCTCCAGG + Intergenic
1065437637 10:25718706-25718728 CGGCACTTGTAGCAAGCTCCTGG - Intergenic
1065443114 10:25772191-25772213 CGGCATGTGTAGCAAGTTCCTGG + Intergenic
1065819925 10:29516321-29516343 TGGCACTTGGAGCCAGCCCTCGG + Intronic
1065834260 10:29642592-29642614 TGGCACATGTTGCTAGGTCCTGG - Intronic
1065901164 10:30209443-30209465 TGGCCCTGGTAGCAAGCCCATGG + Intergenic
1065952993 10:30668564-30668586 TGGCACTTGGAGCCAGCCCTTGG - Intergenic
1066103390 10:32137107-32137129 CAGCACTTGAAGCAAGATCCTGG + Intergenic
1066437208 10:35405931-35405953 CGGCACTTGAAGCAAGATCCTGG + Intronic
1067360411 10:45573472-45573494 CGGCACCTGAAGCAAGTTCCTGG - Intronic
1068360780 10:55973460-55973482 TGGCACTTGAAATAAGATCCTGG - Intergenic
1069888902 10:71640844-71640866 TTGCATTTCTAACAAGCTCCAGG + Intronic
1071400988 10:85270591-85270613 TGGCACTTGTAACCTGCACCAGG - Intergenic
1071550783 10:86564689-86564711 TAGCACTTGAAGCAATATCCTGG + Intergenic
1071916208 10:90297265-90297287 TGGCATGTGTAGCAAGTTCCTGG - Intergenic
1071961117 10:90809685-90809707 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1072011270 10:91304939-91304961 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1072359012 10:94640474-94640496 AGGCACTGGAAGCAATCTCCTGG + Intergenic
1072580267 10:96734472-96734494 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
1072884532 10:99261850-99261872 TGGCACTTGAAGCAAGATCCTGG - Intergenic
1073709483 10:106021071-106021093 TGGCGCTTGTAGCAAGCTCCTGG + Intergenic
1073933212 10:108600062-108600084 AGGCACTTGAAGCAAGATGCTGG - Intergenic
1074019035 10:109564625-109564647 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1074548099 10:114417495-114417517 TGACACTTCTGACAAGCTCCAGG + Intergenic
1074740786 10:116482913-116482935 TGGCACTTGCAGCAAGCTCCTGG - Intergenic
1075248705 10:120847108-120847130 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1077612191 11:3650195-3650217 CGGCACTTGTAGCAAGCTCCTGG - Intronic
1077679060 11:4222697-4222719 CAGCACTTGTAGCAAGCTCCTGG + Intergenic
1077688496 11:4319338-4319360 CAGCACTTGTAGCAAGCTCCTGG + Intergenic
1077766376 11:5163736-5163758 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1077883364 11:6368073-6368095 TGGCACTTGTAGCGAGCTCCTGG - Intergenic
1079230520 11:18645289-18645311 TGGCACTTGCAGCAAGCTCCTGG - Intergenic
1079476127 11:20831270-20831292 TGGCATTTCTAGTAAGCCCCAGG - Intronic
1079672564 11:23187391-23187413 CAGCACGTGTAGCAAGCTCCTGG + Intergenic
1079727066 11:23890634-23890656 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1079847683 11:25490671-25490693 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1080027909 11:27632536-27632558 TGGCACTTGTGGCAAGCTCCTGG + Intergenic
1080227364 11:29975668-29975690 CGGCACTTGTAGCAAACTCGTGG - Intergenic
1080994443 11:37582072-37582094 CGGCACTTGAAGCAAGATCTTGG + Intergenic
1082822062 11:57550787-57550809 TTGCAATTGTTGTAAGCTCCTGG - Intergenic
1083534417 11:63455169-63455191 CATCACTTGTAGCAAGCTCCTGG - Intergenic
1084047173 11:66575878-66575900 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1084232310 11:67761943-67761965 TGGCACTTGTGGCAAGCTCCTGG - Intergenic
1084245592 11:67854860-67854882 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1084355560 11:68635971-68635993 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1084613267 11:70217729-70217751 GGGCACTTGTAGCAAGCTCCTGG + Intergenic
1084827096 11:71739718-71739740 TGTCACTTGTAGCAAGCTCCTGG - Intergenic
1085570199 11:77552192-77552214 CAGCACTTGGAGCAAGATCCTGG - Intronic
1085934273 11:81124083-81124105 CGGCACTTGTAGCAAGCTCCTGG - Intergenic
1085988022 11:81808474-81808496 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1086005026 11:82027480-82027502 TGGCACTTGTAACAAGCTCCTGG - Intergenic
1086134828 11:83435033-83435055 CGGCACTTGTAGCAAGCTCCTGG + Intergenic
1086136262 11:83446355-83446377 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1086550219 11:88045451-88045473 CGGCACTTGTAGCAAGCTCCTGG - Intergenic
1086974881 11:93120209-93120231 CTGCATTTGTAACAAGCTCCCGG + Intergenic
1087099106 11:94347979-94348001 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1087099649 11:94351912-94351934 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1087127825 11:94643876-94643898 TGGCACTTGTAGCGAGCTCCTGG - Intergenic
1087196924 11:95311782-95311804 TGGCACTTGTAGAGAGCTCCTGG - Intergenic
1087314682 11:96590184-96590206 TGGCACGTGTAGCAAGCTCCTGG - Intergenic
1087839534 11:102907531-102907553 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1088081601 11:105923072-105923094 TTGCCCTTGTAGCAAGCCCTTGG + Intronic
1089173373 11:116531624-116531646 TTGCGCTCCTAGCAAGCTCCCGG + Intergenic
1089349101 11:117811541-117811563 TAGCACTTGTAGTAAGCTCCTGG - Intronic
1089471047 11:118720451-118720473 TGGCACTTGTAGCAAGTTCCTGG + Intergenic
1089867042 11:121641376-121641398 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1089987690 11:122829382-122829404 TGGCACTTGTAGGAAGCTCCTGG - Intergenic
1090107592 11:123869050-123869072 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1090526801 11:127546184-127546206 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1090532089 11:127601231-127601253 TGGCAACTGAAGCCAGCTCCAGG - Intergenic
1090546482 11:127772528-127772550 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1090850589 11:130567815-130567837 CCGCACATGTAGCAAGCTCCTGG + Intergenic
1090871951 11:130756962-130756984 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1090926931 11:131257941-131257963 CGGCACTTGTAGCAAGCTCCTGG + Intergenic
1091886524 12:4020790-4020812 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
1092416170 12:8291991-8292013 CGGCACTTGTAGCAAGCTCCTGG + Intergenic
1092592747 12:9966519-9966541 TGGCACTTTTAGCAAGCTCCTGG + Intronic
1092626740 12:10336381-10336403 CAGCATGTGTAGCAAGCTCCTGG + Intergenic
1092739316 12:11613147-11613169 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1092924847 12:13263423-13263445 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1093024338 12:14232839-14232861 TGGCACTTGAAGCAAGATCCTGG - Intergenic
1093268003 12:17025156-17025178 CAGCATGTGTAGCAAGCTCCTGG + Intergenic
1093302236 12:17471809-17471831 TGGCACTTGAAGCAAGATCCTGG - Intergenic
1093321980 12:17723730-17723752 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1093358442 12:18197210-18197232 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1093578823 12:20765636-20765658 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1093584511 12:20820454-20820476 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1093812829 12:23509464-23509486 CGGCACTTGTAGCAAGCTCCTGG + Intergenic
1093951077 12:25165407-25165429 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1094316045 12:29138454-29138476 TGGCATGTGTAGCAAGCTCCTGG + Intergenic
1094400682 12:30058237-30058259 TGGCAGTTGGGGCAAGCTCCTGG - Intergenic
1094825761 12:34267897-34267919 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1095637660 12:44452056-44452078 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1095999019 12:48113584-48113606 CGACACTTGAAGCAAGATCCTGG + Intronic
1096208848 12:49746614-49746636 TGGGACATGCAGCAAGCTGCTGG - Intronic
1097398594 12:59104099-59104121 TGGCACTTGTGGCAAGTTCCTGG - Intergenic
1097641611 12:62190466-62190488 GGGTACTAGTAGCAAGATCCGGG + Intronic
1098402255 12:70087660-70087682 CGGCACGCGTAGCAAGCTCCTGG - Intergenic
1098653821 12:73005416-73005438 TGGCACTTGTAGCAGGCTCCTGG + Intergenic
1099188721 12:79542119-79542141 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
1099292095 12:80786529-80786551 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1099836092 12:87910843-87910865 TGACACTTGTAGCAAGCTCCTGG + Intergenic
1100940303 12:99717447-99717469 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1101278392 12:103226132-103226154 CAGCACTTGTAGCAAGCTCCTGG + Intergenic
1102116736 12:110408714-110408736 CAGCACTTGAAGCAAGATCCTGG + Intergenic
1102399388 12:112615400-112615422 TGGCACTTGGCTCCAGCTCCTGG + Intronic
1102999572 12:117375157-117375179 TGGCACTTTTAGAAACCCCCAGG + Intronic
1105597259 13:21850767-21850789 TGGCACTTCTAGCAGGGTGCTGG - Intergenic
1106212567 13:27663893-27663915 TTGCTCTTGTAGTAAGCACCAGG + Intronic
1106635609 13:31525529-31525551 TTGCATTTCTAGCAAGCTCTAGG + Intergenic
1107220289 13:37972628-37972650 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1108202702 13:48058657-48058679 CGGCACTTATAGCAAGCTCCTGG - Intronic
1108282059 13:48870575-48870597 TGGCACTTGGAGCAAGATCCTGG + Intergenic
1108803865 13:54131143-54131165 TGGCACTTGTAGCAAGCCCCTGG + Intergenic
1108952941 13:56115870-56115892 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1109302786 13:60606358-60606380 CTGCATTTCTAGCAAGCTCCCGG - Intergenic
1110765482 13:79276395-79276417 TGGCACTTGTAGGAAGCTCCTGG - Intergenic
1110845348 13:80185932-80185954 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1110978497 13:81868434-81868456 CAGCACTTGTAGCAAGCTTCTGG - Intergenic
1111126038 13:83911733-83911755 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1111362101 13:87189879-87189901 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1111458834 13:88516277-88516299 CGGCACGTGTAGCAAGCTCCTGG + Intergenic
1111630446 13:90841700-90841722 CGGCATGTGTAGCAAGCTCCTGG - Intergenic
1111631696 13:90852039-90852061 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1111854548 13:93621265-93621287 TGGCACTTGTTGCAACCTGTTGG + Intronic
1112128245 13:96494057-96494079 CTGTAATTGTAGCAAGCTCCAGG - Intronic
1112236834 13:97644576-97644598 CGGCACTTGTAGCAAGCTCCTGG - Intergenic
1112889311 13:104211509-104211531 TGGCACTTGTAGCAAGCTCTTGG + Intergenic
1113324343 13:109267607-109267629 TGGCACTTGCAGCAAGCTCCTGG - Intergenic
1113454728 13:110440131-110440153 TGTCACTCATAGGAAGCTCCTGG + Intronic
1114221683 14:20702843-20702865 TAGCACTTGAAGCAAGATCCTGG - Intergenic
1114288206 14:21265922-21265944 TTGCACTTCTAGTAAGTTCCAGG - Intronic
1115240596 14:31248795-31248817 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1115352133 14:32406988-32407010 TGGCACTTGCCACAAGCTCTAGG - Intronic
1115904814 14:38193051-38193073 CGGCAAGTGTAGCAAGCTCCTGG - Intergenic
1116179683 14:41518203-41518225 CAGCACGTGTAGCAAGCTCCTGG - Intergenic
1116484237 14:45427684-45427706 TGGCACTGGAAGCAAGCCCTAGG - Intergenic
1116490580 14:45498836-45498858 TGGCACTTGTAGCAAGCTTCTGG + Intergenic
1116534774 14:46015856-46015878 TGGCACTTGTAGAAAGCTCCTGG + Intergenic
1116573461 14:46546187-46546209 TGGCACTTGTAGCAAGCTCTTGG - Intergenic
1116702399 14:48258834-48258856 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1116703283 14:48265826-48265848 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1116847809 14:49881025-49881047 TGGCACCTCTAGCAAGGGCCTGG - Intergenic
1117174160 14:53130656-53130678 CGGCACTTGAAGCAAGATCCTGG - Intronic
1117801190 14:59446316-59446338 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1119022439 14:71126586-71126608 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1119317208 14:73705751-73705773 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
1119879821 14:78091428-78091450 AGGCACTTCCAGCAAGCTCAGGG - Intergenic
1120251387 14:82064533-82064555 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1120438045 14:84503657-84503679 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1120539552 14:85736425-85736447 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1120618262 14:86733609-86733631 TGGCACTTGTTGCAAGCTCTTGG - Intergenic
1120659949 14:87238489-87238511 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1120834618 14:89028394-89028416 TGGCATTTCTAACAAGCTCCTGG + Intergenic
1121193296 14:92048161-92048183 CGGCACTTGAAGCAAGATCCTGG + Exonic
1121703657 14:95975208-95975230 TGACACTTGTAGCAAGCTCCTGG - Intergenic
1122381317 14:101309123-101309145 CAGCACTTGAAGCAAGATCCTGG + Intergenic
1123882487 15:24689031-24689053 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1125131510 15:36289093-36289115 CGGCACGTGTAGCAAGCTCCTGG + Intergenic
1125213211 15:37239647-37239669 CGGCACTTGTAGCAAGCTCCTGG + Intergenic
1125629227 15:41133768-41133790 TGGCACTTGAAACAAGATCCTGG - Intergenic
1125849097 15:42886786-42886808 CGGCACTTGAAGCAAGATCCTGG - Intronic
1126400687 15:48266554-48266576 TTGCATTTCTAACAAGCTCCTGG - Intronic
1126530148 15:49702588-49702610 CGGCACTTGTAGCAAGCTCCTGG + Intergenic
1126843754 15:52740847-52740869 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1126912399 15:53430284-53430306 TGGCACTTGTAGGAAGCTCCTGG + Intergenic
1128985779 15:72220156-72220178 TGAGACGTGTAGCAAGCTTCTGG - Intronic
1129259442 15:74356189-74356211 CAGCACTTGAAGCAAGATCCTGG - Intronic
1131447755 15:92513771-92513793 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1131684187 15:94753034-94753056 TAGCACTTGTAGCAAGCTCCTGG - Intergenic
1131684714 15:94756737-94756759 TGGCACTTGTACCAAGCTCCTGG - Intergenic
1132263021 15:100442547-100442569 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1132340419 15:101074797-101074819 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1133765730 16:8836465-8836487 CAGCACGTGTAGCAAGCTCCTGG + Intronic
1133766757 16:8843532-8843554 TGGCACGTGTAGCAAGCTCCTGG + Intronic
1133869537 16:9674565-9674587 TGGCACTTGTAGCAATCTCCTGG + Intronic
1133938182 16:10285415-10285437 CAGCACTTGAAGCAAGCTCCTGG - Intergenic
1136529957 16:30861417-30861439 TGGCACTTGAAGCAAGATCCTGG - Intronic
1137363434 16:47840785-47840807 TGGCACTTGTGGCAAGCTCCTGG - Intergenic
1137526880 16:49244320-49244342 TGGCCCCTGTAAGAAGCTCCAGG + Intergenic
1138759096 16:59521080-59521102 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1139039230 16:62982595-62982617 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1139230595 16:65278701-65278723 GGGCACGTGTAGCAAGCTCCTGG + Intergenic
1139943715 16:70624233-70624255 CGGCACGTGTAGCAAGCTCCTGG + Intronic
1140756759 16:78074556-78074578 TTGCATTTCTAACAAGCTCCAGG + Intergenic
1142234112 16:88913345-88913367 TGGCAGTTTTGGCAAGCTCAGGG - Intronic
1142614922 17:1128543-1128565 TGGAACTTGCAGGAAGCTGCTGG + Intronic
1144104678 17:11974156-11974178 TGGCACTTGTAGTAAGCTCCTGG - Intergenic
1145080661 17:19891911-19891933 CGGCACTTGAAGCAAGATCCTGG + Intergenic
1146597903 17:34185535-34185557 CCGCACATGTAGCAAGCTCCTGG - Intergenic
1147978508 17:44261169-44261191 TGGCCCTTGGAGCAACCACCTGG - Intronic
1148334417 17:46832072-46832094 TGGCACTATTGGCAGGCTCCAGG + Intronic
1149319574 17:55470060-55470082 CGGCACTTGAAGCAAGATCCTGG - Intergenic
1150250700 17:63702926-63702948 TGGCCCTTGGAGAAAGCACCAGG + Exonic
1151622495 17:75254835-75254857 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1151839749 17:76609403-76609425 GGGCACTTGTAGCAAGCTCCTGG + Intergenic
1153112018 18:1602402-1602424 TGGCACTTGGAACAAACTCTTGG + Intergenic
1154326699 18:13396175-13396197 TGGCATTTGTAGAATACTCCAGG + Intronic
1155173825 18:23286301-23286323 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1155270434 18:24136635-24136657 AGGCATTTTTAACAAGCTCCTGG + Intergenic
1155697010 18:28696549-28696571 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1155941554 18:31806066-31806088 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1155962001 18:32002868-32002890 CGGCACTTGAAGCAAAATCCTGG - Intergenic
1156237366 18:35218030-35218052 CAGCACTTGTAGCAAGCTCCTGG - Intergenic
1156251925 18:35359757-35359779 TGGCACTCGTAGCAAGCTCCTGG + Intergenic
1156302254 18:35846155-35846177 CAGCACTTGTAGCGAGCTCCTGG - Intergenic
1156924047 18:42555939-42555961 TGGCACTTGTAGCAAGCTCCAGG + Intergenic
1156938537 18:42738913-42738935 GGGCACTTGTAGCAAGCTCCAGG - Intergenic
1156958185 18:42993135-42993157 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1157906385 18:51573487-51573509 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1158394638 18:57070075-57070097 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1158576690 18:58644430-58644452 CAGCACTTGAAGCAAGCTCCTGG + Intergenic
1159164473 18:64683902-64683924 TGGCTCTTGTAGCAAGTTCCTGG - Intergenic
1161661724 19:5550732-5550754 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
1161711222 19:5849351-5849373 CAAAACTTGTAGCAAGCTCCTGG - Intronic
1161712045 19:5854371-5854393 CGGCACTTGAAGCAAGATCCTGG - Intergenic
1163487294 19:17595690-17595712 CGGCACTTGTAGCAAGCTCCTGG - Intergenic
1164080813 19:21860063-21860085 TGGCACTTGAAGCAAGATGCTGG - Intergenic
1164258768 19:23551525-23551547 TGGCAATTGAAGCAAGATCCTGG - Intronic
1164439153 19:28258873-28258895 TGGCCCTGGTCACAAGCTCCTGG + Intergenic
1164459224 19:28433311-28433333 TGGCACTTGTAGCAAGCTTCTGG + Intergenic
1165249243 19:34516255-34516277 CAGCACTTGAAGCAAGCTCCTGG - Intergenic
1165496999 19:36158866-36158888 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1165510312 19:36262932-36262954 TGGCACTTATAGCAAGCTCCTGG + Intergenic
1165835364 19:38751872-38751894 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1166498935 19:43326951-43326973 CGGCACGTGTAGCAAGCGCCTGG + Intergenic
1166905787 19:46107498-46107520 CAGCACTTGAAGCAAGATCCTGG + Intergenic
1166927135 19:46276774-46276796 CAGCACTTGTAGCAAGTTCCTGG + Intergenic
1167902155 19:52630033-52630055 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1168212112 19:54898334-54898356 CAGTACTTGTAGCAAGCTCCTGG + Intergenic
1168227980 19:55010232-55010254 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
925426327 2:3751527-3751549 TGGCATTTCTAACAAGCTCCTGG - Intronic
925433853 2:3819352-3819374 CGGCACTTGAAGCAAGATCCTGG + Intronic
926407776 2:12572018-12572040 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
926464087 2:13167439-13167461 CGGCATGTGTAGCAAGCTCCTGG + Intergenic
928770182 2:34696114-34696136 TGGCACTTGTAGCAAGCTCTTGG - Intergenic
928778310 2:34791969-34791991 CAGCACTTGTAGCAAGCTCCTGG - Intergenic
928827650 2:35440546-35440568 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
928857175 2:35815342-35815364 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
928928569 2:36601297-36601319 TGGCACTTGTAGTAAGCTCCTGG - Intronic
929340633 2:40812394-40812416 TGGCATTTTTAGGAAGCTTCTGG - Intergenic
929684523 2:44022492-44022514 CGGCACTGGAAGCAAGATCCTGG + Intergenic
929793059 2:45037884-45037906 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
930099074 2:47589116-47589138 TGGCACTTGAAGCAACATCCTGG + Intergenic
930955104 2:57195228-57195250 TGGCATTTGTAGCAAGCTCCTGG - Intergenic
930958386 2:57231150-57231172 CAGCACTTGTAGCAAGCTCCTGG - Intergenic
931026387 2:58116864-58116886 TGGCACTTGTAGCAAGCTCCTGG + Intronic
931042620 2:58315958-58315980 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
931236946 2:60419873-60419895 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
931608920 2:64078618-64078640 TGGCACTTGTGGCAAGCTCCTGG + Intergenic
931625782 2:64254790-64254812 CGGCACATGTAGCAAGCTCATGG - Intergenic
931948262 2:67333859-67333881 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
932159454 2:69447100-69447122 CAGCACTTGTAGCAAGCTCCTGG + Intergenic
932210939 2:69929515-69929537 TGGCACTGATAGAAAGCACCTGG - Intronic
932295859 2:70622889-70622911 CAGCACTTGTAGCAAGCTCCTGG - Intronic
932358813 2:71088492-71088514 TGGCACTTGCAGCAAACTCCTGG + Intergenic
932367642 2:71163132-71163154 CGGCATGTGTAGCAAGCTCCTGG + Intergenic
933013097 2:77090638-77090660 TGGCACTTGTAGCAAGCTCCTGG - Intronic
933079277 2:77967371-77967393 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
933137938 2:78760160-78760182 CGGCACTTGAGGCAAGATCCTGG - Intergenic
933163737 2:79053649-79053671 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
933179763 2:79215267-79215289 TGGCACTTGTAGCAAGCTCCTGG + Intronic
933329515 2:80877915-80877937 CGGCACATGTAGCAAGCTCCTGG + Intergenic
933488340 2:82950677-82950699 AGGCACTTGTGGGAATCTCCTGG + Intergenic
933552388 2:83792358-83792380 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
933589474 2:84215835-84215857 TGGCACTTGGAGACAGGTCCTGG - Intergenic
934141268 2:89050181-89050203 CAGCACTTGAAGCAAGATCCCGG - Intergenic
935125262 2:100217264-100217286 CTGCATTTTTAGCAAGCTCCAGG - Intergenic
935382332 2:102465353-102465375 TAGCACTGGTATCAAACTCCTGG + Intergenic
936017572 2:108971319-108971341 TGGCATTTCTAACGAGCTCCTGG - Intronic
936794288 2:116187717-116187739 CGGCACTTGTAGCAAGCTCCTGG + Intergenic
936870798 2:117132581-117132603 CAGCACTTGAAGCAAGATCCTGG - Intergenic
936883340 2:117281003-117281025 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
937642677 2:124231054-124231076 CTGCATTTGTAACAAGCTCCTGG - Intronic
939083133 2:137686392-137686414 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
939307418 2:140428401-140428423 TGGCACTTGTAGCAAGCTCCTGG - Intronic
939460728 2:142493281-142493303 CAGCACTTGAAGCAAGTTCCTGG + Intergenic
940107354 2:150114872-150114894 CCGCACTTGTAGCAAGCTCCTGG - Intergenic
940182945 2:150955301-150955323 TGGCACTTGAAGCAAGATCCTGG - Intergenic
940508786 2:154586686-154586708 CAGCACTTGTAGCAAGCTCCGGG + Intergenic
940530194 2:154869583-154869605 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
940675798 2:156723517-156723539 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
941340405 2:164298117-164298139 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
941663790 2:168223155-168223177 TGGCAATTGGAGGAAACTCCAGG - Intronic
941935885 2:170981087-170981109 TGGCACTTGTAGCAAGCTTCTGG + Intergenic
942097091 2:172544000-172544022 TGGCACTTGTAGCAAGCTTCTGG - Intergenic
942730286 2:179055204-179055226 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
943412926 2:187563927-187563949 TGGCACTTGTAGCAAGCTCCTGG + Intronic
943421579 2:187673926-187673948 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
943461187 2:188172653-188172675 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
943806656 2:192132685-192132707 TGGCACTTGTAGCAAGCTCCTGG - Intronic
943835408 2:192509742-192509764 CAGCACTTGTAGCAAGCTCCTGG - Intergenic
943865350 2:192920321-192920343 CAGCACTTGTAGCAAGCTTCTGG - Intergenic
943951282 2:194134327-194134349 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
944039838 2:195340417-195340439 TGTCACTTGTATCAGGCTGCTGG + Intergenic
944251039 2:197580374-197580396 CAGCACTTGAAGCAAGATCCTGG - Intronic
944394145 2:199249187-199249209 CAGCACGTGTAGCCAGCTCCTGG - Intergenic
944876126 2:203965365-203965387 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
945153098 2:206810306-206810328 CAGCACATTTAGCAAGCTCCTGG + Intergenic
945301479 2:208219685-208219707 CGGCACTTGTAGCAAGCTCCTGG + Intergenic
945361654 2:208901502-208901524 TGGCACTTGTAGGAAGCTCCTGG - Intergenic
945376106 2:209080333-209080355 TGGCACTTGTAGCAAGCTTCTGG - Intergenic
945394306 2:209301485-209301507 CGGCATGTGTAGCAAGTTCCTGG - Intergenic
945858124 2:215091850-215091872 CGGCACTTGAAGCAAGATCCTGG - Intronic
945938323 2:215924633-215924655 CGGCAAGTGTAGCAAGCTCCTGG - Intergenic
946215025 2:218177480-218177502 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
946781039 2:223193289-223193311 TGGCACTTGTAGCAAGCTCCTGG + Intronic
946871751 2:224091299-224091321 CAGCACTTGTAGCAAGCTCCCGG + Intergenic
946886503 2:224227552-224227574 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
946893279 2:224298937-224298959 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
948390690 2:237609217-237609239 TGGCACTTGTAGCAAGTTCCTGG - Intergenic
1168943274 20:1731191-1731213 TGGCACTTAAAGCAAGATCCTGG + Intergenic
1168974809 20:1956317-1956339 TGGCACTTCTAACAAGTTCCAGG + Intergenic
1170325482 20:15151282-15151304 CAGCACTTGTAGCAAGCTCCTGG + Intronic
1170477117 20:16726432-16726454 CTGCATTTGTAGCAAACTCCCGG - Intergenic
1170820696 20:19754594-19754616 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1172624706 20:36340483-36340505 TGGCGATTGTGGCAAGCCCCTGG - Intronic
1173101917 20:40095610-40095632 CGGCATGTGTAGCAAGCTCCTGG - Intergenic
1173118877 20:40271320-40271342 TGGCACTTGTAGCAATTTCCTGG - Intergenic
1173763770 20:45587645-45587667 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1173887888 20:46477850-46477872 TGGCTATTTTAGCAAGCTGCAGG - Intergenic
1174686070 20:52456586-52456608 TGGCATTTCTAGAAAGTTCCAGG + Intergenic
1175104580 20:56605541-56605563 TTGCATTTCTAGCAAGCTCCAGG - Intergenic
1177031167 21:15983240-15983262 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1177100629 21:16894438-16894460 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1177102679 21:16916250-16916272 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1177119573 21:17123755-17123777 CAGCCCTTGTAGCAAGCTCCTGG - Intergenic
1177840739 21:26231488-26231510 CAGAGCTTGTAGCAAGCTCCTGG + Intergenic
1178001206 21:28163476-28163498 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1178618749 21:34156244-34156266 TGGAACTTGAAGGAAGCTTCTGG - Intergenic
1179015276 21:37590459-37590481 TGGCACTTGTAGCATGCTCCCGG + Intergenic
1179231419 21:39507049-39507071 TGGCACTTGTTGCAAAATCCAGG - Intronic
1179387562 21:40957212-40957234 TGGCATGTGTAGCAAGCTCCTGG - Intergenic
1179650361 21:42804475-42804497 CGGCACTTGTAGCAAGCTCCTGG + Intergenic
1181565471 22:23734317-23734339 TTGCATTTCTAGCAAGTTCCTGG + Intergenic
1182732280 22:32505039-32505061 CGGCGCGTGTAGCAAGCTCCTGG - Intergenic
1182998608 22:34836575-34836597 CAGCACTTGTAGCAAGCTCTTGG - Intergenic
1183635666 22:39060964-39060986 TGGCACTTGAAGCAAGATCCTGG + Intronic
949190391 3:1243260-1243282 TGGCACTTGTAGCAAGCTCCTGG + Intronic
949671159 3:6399941-6399963 CAGCACTTGTAGCAAGCTCCTGG - Intergenic
949827447 3:8179278-8179300 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
950926500 3:16746579-16746601 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
951316311 3:21192647-21192669 TGACACTTGTAGCAAGCTCCTGG + Intergenic
951332322 3:21382011-21382033 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
951762790 3:26163818-26163840 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
951888972 3:27551576-27551598 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
952343556 3:32464858-32464880 TGGCACTTGTAGCAAGCTCCTGG + Intronic
952663452 3:35877773-35877795 CGGCTCTTGTAGAAAGCTCCTGG + Intergenic
952896051 3:38079728-38079750 TGGCACTCGTAGCAAGCTCCTGG + Intronic
953077129 3:39581248-39581270 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
953177197 3:40563241-40563263 TGGCACTTGTAGCAAGCTCCTGG - Intronic
953541284 3:43820897-43820919 TGGCCCATGTAGGAAGCCCCAGG + Intergenic
953599435 3:44348471-44348493 TAGCACTTGAAGCAAGATCCTGG + Intronic
953690485 3:45113669-45113691 TGGCACTTGCAGCAAGTACACGG + Intronic
953834472 3:46330848-46330870 TAGCACTTGAAGCAAGATCCTGG + Intergenic
953841159 3:46391186-46391208 CGGCACTTGAAGGAAGATCCTGG + Intergenic
954969263 3:54637931-54637953 CGGCATGTGTAGCAAGTTCCTGG + Intronic
955253370 3:57305940-57305962 TGGCACTTGTAGCAAGCTCCTGG - Intronic
956548984 3:70438311-70438333 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
956709222 3:72025250-72025272 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
957059895 3:75473480-75473502 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
957155113 3:76536100-76536122 TGGCATTTGAGGCAAGGTCCTGG + Intronic
957295239 3:78326064-78326086 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
957317308 3:78586595-78586617 CGGCATATGTAGCAAGCTCCTGG + Intergenic
957985692 3:87571618-87571640 TGGCACTTGAAGCAAGATCCTGG - Intergenic
958421959 3:93940062-93940084 CGGCACTTGAAGCAAGATCCTGG - Intronic
958676809 3:97276433-97276455 CAGTACTTGTAGCAAGCTCCTGG + Intronic
959288347 3:104443367-104443389 CGGCACGTGTAGCAAGCTCTTGG + Intergenic
959485770 3:106926178-106926200 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
959543691 3:107570090-107570112 CAGCACTTGAAGCAAGATCCTGG + Intronic
959972263 3:112421013-112421035 CGGCACGTGTAGCAAGCTCCTGG + Intergenic
960282873 3:115796954-115796976 CGGCACGTGTAGCAAGCTCCTGG + Intergenic
960310110 3:116108767-116108789 TGGCACTTGTAGCAAGCTCCTGG + Intronic
961164758 3:124756001-124756023 TGGTACGTGTAGCAAGCTCCTGG + Intergenic
961171385 3:124800139-124800161 TGTAACTTGAAGCAAGCTACAGG - Intronic
961293514 3:125865965-125865987 TGGCACTAGTAGCAAGCTCCTGG - Intergenic
961379053 3:126485520-126485542 CAGCATTTCTAGCAAGCTCCTGG - Intronic
961711621 3:128832640-128832662 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
961730591 3:128961967-128961989 TGGCACTTGTAGCAAGCTCCTGG - Intronic
961881051 3:130061534-130061556 TGACACTTGTAGCAAGCTCCTGG - Intergenic
961893710 3:130150588-130150610 TGGCACTTGTAGCAAGCTTCTGG + Intergenic
962205570 3:133431390-133431412 TGGCACTTGAAGCAAGCTCCTGG - Intronic
962523964 3:136221326-136221348 TGGCATTTGAAGCAAGGTCCAGG + Intergenic
962660637 3:137597735-137597757 TGGCACCTTTAGCAAGCTCCTGG - Intergenic
963058627 3:141207225-141207247 TGGCACTTGTAGGAAGCTCCTGG - Intergenic
963111836 3:141694735-141694757 CAGCACTTGAAGCAAGATCCTGG + Intergenic
963319749 3:143799544-143799566 CGGCACTTGTAGCAAGCTCCTGG - Intronic
963425221 3:145115241-145115263 CGGCACTTGTAGCAAGCTCCTGG - Intergenic
963456657 3:145554624-145554646 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
963521628 3:146364314-146364336 TGGCACTTGTAGCAAACTCCTGG - Intergenic
963663348 3:148153912-148153934 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
963684335 3:148416609-148416631 TGGCACATGTAGCAAGCTCCTGG - Intergenic
963902081 3:150742583-150742605 TGCCACTTGCAGGAAGCACCAGG + Exonic
964067878 3:152599601-152599623 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
964067901 3:152599704-152599726 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
964125449 3:153230142-153230164 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
964300249 3:155278631-155278653 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
964940954 3:162157588-162157610 CAGCACTTGTAGCAAGCTCCTGG + Intergenic
964983639 3:162714663-162714685 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
964984867 3:162725972-162725994 TGGCACTTGTAGCAAGCTACTGG + Intergenic
965070333 3:163909804-163909826 TGACACTTGTAGCAAGCTCCTGG - Intergenic
965105225 3:164345568-164345590 CAGCACTTGTAGCAAGCTCCTGG + Intergenic
965262648 3:166504234-166504256 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
965286728 3:166827552-166827574 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
965336332 3:167433476-167433498 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
965624878 3:170675971-170675993 TGGCACTTATAGCAAGCTCCTGG + Intronic
965626306 3:170686773-170686795 CAGCACTTGTAGCAAGCTCCTGG + Intronic
965640036 3:170821407-170821429 TGGCACTTATAGCAAGCTCCTGG + Intronic
965713412 3:171578675-171578697 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
965861966 3:173159357-173159379 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
966085435 3:176063596-176063618 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
966105081 3:176325072-176325094 TGGCACTTGCAGCAAGCTCCTGG + Intergenic
966232844 3:177669288-177669310 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
966279307 3:178209793-178209815 TGGCACTTGTAGGAAGCTCCTGG - Intergenic
966397657 3:179519123-179519145 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
966854133 3:184182651-184182673 TGGCACCTCCTGCAAGCTCCTGG + Intronic
967005358 3:185377981-185378003 CGGCACTTGTAGCAAGCTCCTGG + Intronic
967244163 3:187469720-187469742 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
967496225 3:190146766-190146788 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
967643826 3:191898818-191898840 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
967658103 3:192074534-192074556 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
967740489 3:192997944-192997966 CGGCACTTGTAGCAAGCTCCTGG - Intergenic
968993387 4:3929639-3929661 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
969003808 4:4003665-4003687 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
969654096 4:8486231-8486253 TGGCACTTGTAGCAAGCTCCTGG + Intronic
969749059 4:9096520-9096542 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
969810119 4:9641160-9641182 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
970029230 4:11657182-11657204 CGGCACATGTAGCAAGCTCCTGG + Intergenic
970042094 4:11808534-11808556 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
970087551 4:12366023-12366045 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
970201538 4:13613152-13613174 TGGCACCAGTTGCAAGTTCCGGG - Intronic
970256418 4:14173979-14174001 TGGTACTTGTAGCAAGCTCCTGG + Intergenic
970532739 4:16999923-16999945 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
971180567 4:24325471-24325493 TGACACTTGTAGCAAGCTCCTGG - Intergenic
971260964 4:25056902-25056924 TGACACTGGTTGCAGGCTCCTGG - Intergenic
971493953 4:27244163-27244185 GTGCATTTCTAGCAAGCTCCAGG - Intergenic
971552653 4:27976225-27976247 CAGCACTTGAAGCAAGATCCTGG - Intergenic
973751128 4:54022064-54022086 TGGCACTTGAAGCAAGCTCCTGG - Intronic
974428395 4:61767741-61767763 CGGCATGTGTAGCAAGTTCCTGG + Intronic
975079687 4:70261374-70261396 TGGCACTGGTAGCATCATCCAGG - Intergenic
975079696 4:70261496-70261518 TGGAACTTTCAGCAAGCTCTGGG - Intergenic
976558574 4:86476848-86476870 TGGCACTTGTAGCAAGCTCCTGG - Intronic
976739954 4:88347200-88347222 CGGCACTTGAAGCAAGATCCTGG + Intergenic
977010319 4:91626348-91626370 TGGCACTTGTGGCAAGCTCCTGG - Intergenic
977012921 4:91658075-91658097 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
977062505 4:92274943-92274965 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
977217151 4:94296668-94296690 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
977782435 4:100995232-100995254 CCGCACTTGAAGCAAGTTCCCGG + Intergenic
978001116 4:103557216-103557238 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
978031487 4:103943399-103943421 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
978303226 4:107293873-107293895 CAGCACTTGAAGCAAGATCCTGG + Intergenic
978438614 4:108711285-108711307 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
979054619 4:115979106-115979128 TGGCAATTATAGGAAGCTCCTGG + Intergenic
979146622 4:117254358-117254380 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
979806798 4:124983518-124983540 TTGCATTTCTAACAAGCTCCAGG + Intergenic
979895155 4:126148589-126148611 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
980003349 4:127514899-127514921 TGGCACTTGTAACAAGCTCCTGG + Intergenic
980111923 4:128644307-128644329 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
980284950 4:130769618-130769640 TGGCACTTGTAGCAAGTTTCTGG - Intergenic
980388928 4:132120458-132120480 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
980472438 4:133267145-133267167 TGGCATGTGTAGCAAGCTCCTGG + Intergenic
980527872 4:134014432-134014454 TGGCACTTGTAGCAAGTTCCTGG - Intergenic
980528948 4:134025475-134025497 TGGCACTTATACACAGCTCCTGG - Intergenic
980575633 4:134681359-134681381 TGGCACTTGTAGCAAGCTACTGG + Intergenic
980611773 4:135170743-135170765 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
980903941 4:138930129-138930151 TGGCACTTGTAGCAAGCTACTGG - Intergenic
981040247 4:140215752-140215774 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
981482724 4:145254998-145255020 TGGAACTTGAAGCAAGATCCTGG + Intergenic
981525213 4:145701358-145701380 TGGCACTTGTAGCAAGCTCCTGG - Intronic
982083964 4:151816055-151816077 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
982166532 4:152618326-152618348 TGGCACTTGTAACAAGATGGAGG + Intergenic
982396715 4:154922291-154922313 CAGCACTTGTAGCAAGCTCCTGG + Intergenic
982414193 4:155111914-155111936 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
983023874 4:162711359-162711381 TGGCACTTGTGGCAAGCTCCTGG - Intergenic
983055491 4:163095346-163095368 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
983345559 4:166522780-166522802 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
983448063 4:167878528-167878550 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
983452338 4:167925152-167925174 TGGCACTTGTAACAAGCTCCTGG - Intergenic
983659575 4:170118712-170118734 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
983707677 4:170679750-170679772 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
983805787 4:171989483-171989505 CGGCACTTGTAGCAAACTCCTGG + Intronic
983883755 4:172959822-172959844 CAGCACTTGTAGCAAGCTCCTGG + Intronic
984099044 4:175464887-175464909 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
984165353 4:176298301-176298323 CAGCACTTGTAGCAAGCTCCTGG + Intergenic
984322191 4:178209380-178209402 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
984393611 4:179168342-179168364 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
984411730 4:179405476-179405498 TGGCACTGGAAGCAAGATCCTGG - Intergenic
984437266 4:179722704-179722726 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
985057393 4:186047650-186047672 CGGCACTTGTAGCAAGCTCTTGG + Intergenic
985389867 4:189482916-189482938 CGGCACGTGTAGCAAGCTCCTGG + Intergenic
985582358 5:705047-705069 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
986502642 5:8416354-8416376 CAGCACTTGAAGCAAGATCCTGG - Intergenic
986555039 5:9001998-9002020 TGGCACTTGCAGCAAGCTCCTGG + Intergenic
986905777 5:12492059-12492081 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
986970011 5:13322435-13322457 TGCCCCTTGTACCAAACTCCAGG + Intergenic
987282043 5:16422272-16422294 TGACACTTGTAGCAAGCTTCTGG - Intergenic
987486839 5:18535933-18535955 CGGCATGTGTAGCAAGCTCCTGG - Intergenic
988199100 5:28047897-28047919 CGTCACTTGGAGCAAGATCCTGG - Intergenic
989688898 5:44118187-44118209 CAGCACTTGAAGCAAGATCCTGG + Intergenic
992394665 5:76359612-76359634 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
992452000 5:76883836-76883858 CAGCACTTGTAGCAAGCTCCTGG + Intronic
992960833 5:81955516-81955538 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
993836710 5:92826233-92826255 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
993984269 5:94578818-94578840 CTGCATTTGTAGCAAGTTCCTGG + Intronic
993997304 5:94738070-94738092 TGGCACTTGTGGCAAACTGCAGG + Intronic
994126107 5:96170329-96170351 TGGCACTTGTAGCAAGCTGCGGG + Intergenic
994295151 5:98081323-98081345 TGTCACTTGTAGCAAGCTCCTGG - Intergenic
994320780 5:98392340-98392362 TGCCACCTGTAGGAAGCTGCTGG - Intergenic
994324878 5:98436826-98436848 TGGCACTTGAGGCAAGTACCTGG - Intergenic
994375783 5:99014760-99014782 TGGCACTTGAAGGGAACTCCTGG + Intergenic
994532542 5:100987706-100987728 CAGCATGTGTAGCAAGCTCCTGG + Intergenic
994775687 5:104033875-104033897 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
994778945 5:104067640-104067662 CGGCATGTGTAGCAAGCTCCTGG + Intergenic
994989556 5:106980638-106980660 TGGCACTTGTAGCAAGCTCATGG - Intergenic
995125158 5:108571909-108571931 CGGCACTTGTAGCAAGCTCTTGG + Intergenic
995296679 5:110532099-110532121 TGGCACTTGTAGCAAGCTCCTGG - Intronic
996052672 5:118950660-118950682 CAGCACTTGAAGCAAGATCCTGG + Intronic
996358620 5:122622320-122622342 CAGCACTTGTAGCAAGCTCCTGG + Intergenic
996509902 5:124306051-124306073 CGGCACTTGTAGCAAGCTCCTGG - Intergenic
996528057 5:124499312-124499334 CAGCACTTGTAGCAAGCTCCTGG - Intergenic
996574997 5:124970052-124970074 TGGCACTTGTAGCAAGCTGGGGG + Intergenic
996878050 5:128261803-128261825 TTGCACTCGTAGCATGCTTCTGG + Exonic
996912443 5:128670673-128670695 TGGCCCTTGTAGCAGGCTCCTGG + Intronic
996917684 5:128731804-128731826 TGGCACTTGAAGCAAGATCCTGG - Intronic
997746404 5:136303571-136303593 TGGCACTTGTAGCAAGCTCCTGG - Intronic
997772641 5:136568800-136568822 TGGCACATGTAAAAAGCTCCTGG + Intergenic
998693700 5:144614790-144614812 CGGCACATGTAGCAAGCTCTTGG + Intergenic
998996395 5:147872425-147872447 TGGCACTTGTAGGAAGCTCCTGG + Intronic
999618867 5:153453162-153453184 TGGCACGTGTAGCAAGCTTCTGG + Intergenic
999736425 5:154516761-154516783 TGGCACTTGGTGCTAGCTCAGGG + Intergenic
1000438589 5:161242225-161242247 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1000439724 5:161250750-161250772 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1000519402 5:162278829-162278851 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1000885318 5:166742543-166742565 CGGCATGTGTAGCAAGCTCCTGG + Intergenic
1000935639 5:167301340-167301362 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1001331446 5:170765486-170765508 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1002610957 5:180418178-180418200 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1003430163 6:6031235-6031257 CGGCACTTGTAGTAAGCTCCTGG + Intergenic
1004018313 6:11752574-11752596 TGACACTTGTAGCAGCTTCCTGG - Intronic
1004507993 6:16262445-16262467 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1004575225 6:16888214-16888236 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1004768571 6:18757518-18757540 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1004837005 6:19541162-19541184 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1005786571 6:29250659-29250681 CGGCACTTGAAGCAAGATCCTGG + Intergenic
1008018829 6:46552774-46552796 TTGCATTTCTAACAAGCTCCAGG - Intronic
1008476529 6:51940441-51940463 CAGCACTTGTAGTAAGCTCCTGG - Intronic
1009269824 6:61602360-61602382 TGGCACTCGTAGCAAGATCCTGG - Intergenic
1009379148 6:63007572-63007594 CAGCACTTGTAGCAAGCTCCTGG - Intergenic
1010007831 6:71015004-71015026 TTGCATTTCTAACAAGCTCCAGG + Intergenic
1010071721 6:71752000-71752022 TGGCACTTGTAGCAAGTTCCTGG + Intergenic
1010826909 6:80485890-80485912 TGGCACTTGTAGCAAACTCCTGG + Intergenic
1010829687 6:80513758-80513780 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1010841311 6:80651250-80651272 TGGCACTTCTAGCAAGCTCCTGG + Intergenic
1010894542 6:81348590-81348612 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1011367896 6:86601823-86601845 TGGCACTTGTAGCAAGATCCTGG + Intergenic
1011770941 6:90673665-90673687 CGGCAAGTGTAGCAAGCTCCTGG + Intergenic
1012675102 6:102104214-102104236 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1013244935 6:108277381-108277403 TCGCATTTCTAGCAAGTTCCAGG + Intergenic
1013407885 6:109859208-109859230 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1013843678 6:114425776-114425798 CGGCATGTGTAGCAAGCTCCTGG + Intergenic
1013891706 6:115034138-115034160 CGGCATGTGTAGCAAGCTCCTGG - Intergenic
1014115339 6:117663138-117663160 CGGCACTTGAAGTAAGATCCTGG + Intergenic
1014360157 6:120465719-120465741 CAGCATGTGTAGCAAGCTCCTGG + Intergenic
1014612087 6:123558899-123558921 CGGCACTTGTGGCAAGGTCCTGG - Intronic
1014614670 6:123585741-123585763 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1014793988 6:125705314-125705336 TGGCACATGTAGCAAGCTCCTGG + Intergenic
1014891547 6:126851011-126851033 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1015165223 6:130194601-130194623 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1015266738 6:131297713-131297735 CGGCACATGTAGCAAGCTCCTGG - Intergenic
1015269660 6:131325660-131325682 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1015271376 6:131341138-131341160 TGGCACTTGTAGTAAGCTCCTGG - Intergenic
1015278156 6:131405070-131405092 CGGCACATGTAGCAAGCTCCTGG - Intergenic
1015801374 6:137064778-137064800 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1016114138 6:140260863-140260885 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1016204539 6:141455087-141455109 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1016254370 6:142086817-142086839 TGGCATTGGTAGCAAGACCCAGG - Intronic
1016518809 6:144925429-144925451 CGGCATGTGTAGCAAGCCCCTGG - Intergenic
1016535756 6:145106602-145106624 TGACACTTGTAGCAAGCTCCTGG + Intergenic
1016650288 6:146453868-146453890 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1016853272 6:148642057-148642079 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1017269817 6:152492471-152492493 CAGCACTTGAAGCAAGATCCTGG - Intronic
1017389501 6:153923742-153923764 CGGCACGGGTAGCAAGCTCCTGG - Intergenic
1017656447 6:156633981-156634003 TGGCAGATGGAGCAAGGTCCAGG + Intergenic
1017779328 6:157704100-157704122 CAGCACTTGTAGCAACCTCCTGG + Intronic
1018077600 6:160230752-160230774 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1018084493 6:160290024-160290046 TGGCACCTGTAGCAAGCTCCTGG + Intergenic
1018495400 6:164342186-164342208 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1018521466 6:164655604-164655626 TGGCACCTGTAGCAAGCTCCTGG + Intergenic
1019961789 7:4466631-4466653 TTGCATTTCTAACAAGCTCCTGG - Intergenic
1020316053 7:6906047-6906069 TGACACTTGTAGCAAGCTCTTGG - Intergenic
1020323942 7:6960120-6960142 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1020532711 7:9356872-9356894 CGGCATGTGTAGCAAGCTCCTGG + Intergenic
1020541138 7:9462008-9462030 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1020794217 7:12661824-12661846 TGGCACTTGAAGCAAGCTCCTGG - Intergenic
1021393626 7:20122860-20122882 TGGCACTTGTAGCAAGCTTCTGG - Intergenic
1021429852 7:20547706-20547728 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1021637320 7:22705501-22705523 CAGCACTTGTAGCAAGCTCCTGG - Intergenic
1021660628 7:22915376-22915398 CAGCACTTGAAGCAAGATCCTGG - Intergenic
1021810666 7:24398534-24398556 CAGCACTTGTAGCAAGCTCCTGG - Intergenic
1021977892 7:26027640-26027662 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1022151397 7:27611221-27611243 TGGCGCTTGTAGTTAGCCCCAGG - Intronic
1022372876 7:29787104-29787126 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1022514157 7:30964839-30964861 TGTCACTTGCAGTAACCTCCTGG - Intronic
1022572789 7:31470480-31470502 TTGCACTTGTAGCAAGCTCCTGG + Intergenic
1022710043 7:32841356-32841378 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1022854706 7:34303345-34303367 TGGCACTTGTAGCAAGTTCCTGG + Intergenic
1023130164 7:36995013-36995035 TGGAACTGGCACCAAGCTCCAGG - Intronic
1023698883 7:42874060-42874082 TGGCACTTGTAACAAGTTCCTGG + Intergenic
1024246873 7:47477368-47477390 TGGCACTTGTACCCACCCCCAGG - Intronic
1024739250 7:52337098-52337120 CAGCACTTGAAGCAAGATCCTGG + Intergenic
1025790108 7:64680941-64680963 TGGCACTTGAAGCATGGCCCTGG - Intronic
1027157889 7:75781410-75781432 TGGCACTTGAATCAAGATCCTGG - Intronic
1027158319 7:75784186-75784208 TAGCACTTATAGCAAGCTCCTGG - Intronic
1027851948 7:83461922-83461944 CGGCACATGTAGCAAGCTCCTGG - Intronic
1028589907 7:92483241-92483263 CGGCACTTGAAGCAAGATCCTGG + Intergenic
1028670513 7:93396188-93396210 TGGCACTTGCAGCAAGCTCCTGG - Intergenic
1028690181 7:93642118-93642140 TGGCACTTGCAGCAAGCTCCTGG - Intronic
1029500217 7:100924427-100924449 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1030163607 7:106531854-106531876 CAGCACTTGTAGCAAGCTCCTGG + Intergenic
1030441684 7:109595479-109595501 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1030445780 7:109645571-109645593 TGGCACTTGAAGCAAGATCCTGG + Intergenic
1030751495 7:113237031-113237053 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1031004671 7:116457741-116457763 CGGCACGTGTAGCAAGCTCCTGG - Intronic
1031243148 7:119271169-119271191 TGACACTTGTAGCCAGCGTCAGG - Intergenic
1031296619 7:120011147-120011169 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1031355192 7:120780597-120780619 CCACACTTGTAGCAAGCTCCTGG + Intergenic
1031364743 7:120889065-120889087 CAGCACCTGTAGCAAGCTCCTGG + Intergenic
1031399988 7:121317829-121317851 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1031422452 7:121567432-121567454 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1031685849 7:124731296-124731318 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1031727929 7:125262355-125262377 TGGCACTTATAGCAAGCTCCTGG + Intergenic
1031777347 7:125919871-125919893 TGGCACTTGTAGCAAGCTCTTGG - Intergenic
1031997575 7:128242717-128242739 TGGCACTTGGAGCCATTTCCTGG - Intronic
1032490505 7:132320773-132320795 TGGCATTTCTAACAAGTTCCCGG - Intronic
1033084720 7:138331286-138331308 TGGCACTTGAAGCAAGATCCTGG - Intergenic
1033088560 7:138364808-138364830 TGGCACTTGAAGCAAGATCCTGG - Intergenic
1033211521 7:139463549-139463571 TGGCACTTGAAGCAAGATCCTGG - Intronic
1033465031 7:141582238-141582260 TGGCACTTGAAGCAAGTTCCTGG + Intronic
1033625590 7:143107079-143107101 CGGCACTTGAAGCAAGATCCTGG - Intergenic
1033675948 7:143540675-143540697 CGGCACTTGTAGCAAGCTCCTGG + Intergenic
1033695887 7:143788764-143788786 CAGCACTTGTAGCAAGCTCCTGG - Intergenic
1033909465 7:146246832-146246854 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1034084830 7:148313503-148313525 CAGCACTTGTAGCAAGCTCCCGG + Intronic
1035054194 7:156023032-156023054 CTGCACTTCTAGGAAGCTCCTGG - Intergenic
1035188040 7:157141020-157141042 GGCCAATTGTAGCATGCTCCTGG - Intronic
1035471440 7:159112398-159112420 TGGCACTGGCTGCAACCTCCTGG + Intronic
1035880661 8:3241669-3241691 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1036070920 8:5440094-5440116 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1036281485 8:7404695-7404717 TTGCATATGTAGCAAGCTCCTGG - Intergenic
1036339984 8:7906877-7906899 TTGCATATGTAGCTAGCTCCTGG + Intergenic
1036372134 8:8170864-8170886 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1036472327 8:9062888-9062910 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1036639496 8:10573526-10573548 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1036878767 8:12494777-12494799 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1038118049 8:24579948-24579970 TGGCACTTGTATCAGACTTCTGG + Intergenic
1039499000 8:38002130-38002152 CAGCACTTGAAGCAAGATCCTGG + Intergenic
1041243383 8:55868628-55868650 TGGCATCTGTAGTAACCTCCAGG - Intergenic
1041917531 8:63151750-63151772 CTGCACTTGAAGCAAGATCCTGG + Intergenic
1042453560 8:68975429-68975451 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
1042707372 8:71677169-71677191 CGGCGCGTGTAGCAAGCTCCTGG - Intergenic
1043353668 8:79389558-79389580 CAGCACGTGTAGCAAGCTCCTGG + Intergenic
1043597452 8:81901990-81902012 TGGCACTTGAAGCAAGATCCTGG + Intergenic
1043598847 8:81915704-81915726 TGGCACTTGAATTAAGATCCAGG - Intergenic
1043717894 8:83508594-83508616 TGGTAGTTGTGGCAAGCTCCTGG + Intergenic
1043720909 8:83546227-83546249 TGGCACTTGAAGCAAGATCCTGG - Intergenic
1043837740 8:85065230-85065252 CAGCACTTATAGCAAGCTCCTGG - Intergenic
1044095582 8:88060039-88060061 AGGCAAGTGTAGCAAGTTCCTGG + Intronic
1044148514 8:88745668-88745690 TGGCACGTGTAGCAAGCTCTTGG + Intergenic
1044213600 8:89580790-89580812 CTGCACTTTTAACAAGCTCCTGG + Intergenic
1044258612 8:90093657-90093679 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1044417087 8:91950225-91950247 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1044921994 8:97177332-97177354 CGGCACATGTAGCAAGCTCCTGG - Intergenic
1044925161 8:97203176-97203198 CGGCATGTGTAGCAAGCTCCTGG - Intergenic
1045197524 8:99946127-99946149 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
1046294122 8:112198080-112198102 TGGCACTCGTAGCAAGCTCCTGG - Intergenic
1046440015 8:114243594-114243616 CGGCACGTGTCGCAAGCTCCTGG - Intergenic
1046559284 8:115816865-115816887 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1047179625 8:122574482-122574504 TGGTACTTCTAACATGCTCCTGG + Intergenic
1047699349 8:127433985-127434007 CGGCACATGTAGCAAGCTCCTGG - Intergenic
1047856376 8:128916676-128916698 TGGCATTTGTGGCAAGCTCCTGG - Intergenic
1048097613 8:131312462-131312484 TGGCACTTGTAGCAAGCTCTGGG - Intergenic
1048135474 8:131742978-131743000 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1048143775 8:131821442-131821464 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1048585417 8:135770594-135770616 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1048728417 8:137411728-137411750 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1048764233 8:137828269-137828291 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1049868815 8:144957712-144957734 TGGCACCTGTAGCAAGCTCCTGG + Intergenic
1050117605 9:2277824-2277846 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1050258104 9:3814604-3814626 TGGCACTTGTAGCAAGCTTCTGG + Intergenic
1050493135 9:6210807-6210829 TGGCACTAGCAGCATGCACCTGG + Intergenic
1050896077 9:10887024-10887046 TGGCACTTACAGCAAGCTCCTGG - Intergenic
1051849282 9:21489154-21489176 TGGCACTTGCAGCAAACTCCTGG + Intergenic
1051953403 9:22662020-22662042 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1052163086 9:25289930-25289952 CAGCACTTGTAGCAAGCTCCTGG - Intergenic
1052322093 9:27178800-27178822 TGATACTTGTAATAAGCTCCTGG - Intronic
1052653337 9:31328672-31328694 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1052720638 9:32167964-32167986 TGGCACTTGCAGCAAGCTCCTGG + Intergenic
1053058035 9:35005746-35005768 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1053059918 9:35022760-35022782 CAGCACTTGAAGCAAGATCCTGG + Intergenic
1053534225 9:38910229-38910251 TGGCACCTGTAGCTAACTCCAGG - Intergenic
1054206449 9:62134648-62134670 TGGCACCTGTAGCTAACTCCAGG - Intergenic
1054631909 9:67453698-67453720 TGGCACCTGTAGCTAACTCCAGG + Intergenic
1054807485 9:69408205-69408227 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1055233065 9:74087921-74087943 TGGCACGTGTAGCAAGCTCCTGG - Intergenic
1055347715 9:75355233-75355255 TGGCACTTGTGGCAAGCTCCTGG + Intergenic
1055626725 9:78183065-78183087 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1055810049 9:80139669-80139691 CAGCACATGTAGCAAGCTCCTGG - Intergenic
1055881750 9:81011265-81011287 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1056061162 9:82886015-82886037 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1056323888 9:85460904-85460926 CGGCACGTGTCGCAAGCTCCTGG - Intergenic
1056721909 9:89079612-89079634 TGGGTCCTGTTGCAAGCTCCAGG - Intronic
1057234849 9:93349863-93349885 CGGCACGTGTAGCAAGCTCCTGG - Intergenic
1057812578 9:98269263-98269285 CGGCACTTGTAGCAAGCTCCTGG + Intergenic
1058612405 9:106790455-106790477 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1058899731 9:109431382-109431404 TGGCACCTGGAGGAAGCCCCCGG + Intronic
1059546155 9:115178072-115178094 CGGCACTTGTAGCAAGCTCCTGG + Intronic
1059574624 9:115475617-115475639 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1060318465 9:122534086-122534108 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1060588123 9:124799470-124799492 GGGCACTGGTAGCAAGGCCCAGG + Exonic
1060737880 9:126078080-126078102 TGGCACTTGTAGCAAGCGCCTGG + Intergenic
1061010979 9:127954565-127954587 TGGCACTTGGAGCAGGCTCCAGG - Intronic
1061583070 9:131549344-131549366 CAACACTCGTAGCAAGCTCCTGG - Intergenic
1061787628 9:133039695-133039717 TGGCTCATTTAGCAAGATCCCGG - Intronic
1185858426 X:3556576-3556598 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1185991064 X:4893850-4893872 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1186112861 X:6275630-6275652 TGACACTTGTAGCAAGCTCCTGG + Intergenic
1186532864 X:10314818-10314840 GTGCACTTGAAGGAAGCTCCAGG - Intergenic
1186784071 X:12942081-12942103 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1187086519 X:16048139-16048161 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1187099954 X:16182609-16182631 TGGCACTTTTAGCAAGCTCCTGG + Intergenic
1187103764 X:16220273-16220295 CAGCACTTAAAGCAAGCTCCTGG + Intergenic
1187388229 X:18867919-18867941 CTGCATTTCTAGCAAGCTCCAGG - Intergenic
1188333016 X:28896042-28896064 CGGCACTTGTAGCAAGCTCCTGG + Intronic
1188552655 X:31379763-31379785 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1191014192 X:55791758-55791780 CGGCGCTTGAAGCAAGATCCTGG + Intergenic
1192177932 X:68897536-68897558 TGGCAAGTGAAGCCAGCTCCGGG + Intergenic
1192706146 X:73529924-73529946 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1193885932 X:86984064-86984086 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1194186245 X:90776769-90776791 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1194308537 X:92276510-92276532 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1194502978 X:94702270-94702292 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1194660692 X:96626285-96626307 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1194873796 X:99162888-99162910 CAGCACTTATAGCAAGCTCCTGG + Intergenic
1195016950 X:100789871-100789893 CGGCACTTGAAGCAAGATCCTGG + Intergenic
1195291152 X:103432980-103433002 TGGCACTTGAAGCAAGTTCCTGG + Intergenic
1195326856 X:103765226-103765248 CAGCACTTGAAGCAAGTTCCTGG + Intergenic
1195841489 X:109180680-109180702 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1195908674 X:109868666-109868688 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1196220982 X:113112169-113112191 CGGCACTTGTGGCAAGCTCCTGG + Intergenic
1196227214 X:113180251-113180273 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1196300015 X:114042242-114042264 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1196496868 X:116333082-116333104 CGGCACTTGTAGCAAGCTCCTGG - Intergenic
1196525472 X:116724401-116724423 CCACATTTGTAGCAAGCTCCTGG + Intergenic
1196572502 X:117281418-117281440 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1196585126 X:117419922-117419944 CGGCACTTATACCAAGCTCCTGG - Intergenic
1196773850 X:119321216-119321238 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1196992682 X:121346440-121346462 TGGCACTTGTGGCAAGCTCCTGG + Intergenic
1197352055 X:125392296-125392318 TGGCATGTGTAGCAAGCTCCTGG + Intergenic
1197470966 X:126865362-126865384 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1197499725 X:127228859-127228881 TGGCACTTGTAGCAAGCTTCTGG - Intergenic
1197933086 X:131714331-131714353 CGGCACTTGTAGCAAGCTCCTGG - Intergenic
1198598451 X:138261079-138261101 AGGTACTTATAGCAAGTTCCTGG - Intergenic
1198599396 X:138267760-138267782 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1198965927 X:142228809-142228831 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1198983753 X:142427016-142427038 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1199034126 X:143031584-143031606 TTGCACTTATAACAGGCTCCTGG + Intronic
1199037990 X:143076382-143076404 TTGCATTTGTAACAAGTTCCTGG + Intergenic
1200532835 Y:4358848-4358870 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1200611140 Y:5328233-5328255 TGGCATGTGTAACAAGTTCCTGG + Intronic
1201307502 Y:12563379-12563401 TGGCACTTGAAGCAAGATCCTGG + Intergenic
1201473502 Y:14357847-14357869 TGGCACTTGAAGCAAGATCCTGG + Intergenic
1201540632 Y:15101690-15101712 CAGCACTTGAAGCAAGATCCTGG + Intergenic
1201581394 Y:15514634-15514656 TGGCATTTGTAGCAAGCTCCTGG - Intergenic