ID: 1173763771

View in Genome Browser
Species Human (GRCh38)
Location 20:45587646-45587668
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1006
Summary {0: 307, 1: 190, 2: 139, 3: 92, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173763766_1173763771 1 Left 1173763766 20:45587622-45587644 CCTTGGCCTGGTGGCCAGATTTC 0: 158
1: 207
2: 446
3: 128
4: 205
Right 1173763771 20:45587646-45587668 GGCACTTGTAGCAAGCTCCTGGG 0: 307
1: 190
2: 139
3: 92
4: 278
1173763768_1173763771 -5 Left 1173763768 20:45587628-45587650 CCTGGTGGCCAGATTTCTGGCAC 0: 157
1: 314
2: 214
3: 192
4: 217
Right 1173763771 20:45587646-45587668 GGCACTTGTAGCAAGCTCCTGGG 0: 307
1: 190
2: 139
3: 92
4: 278
1173763763_1173763771 17 Left 1173763763 20:45587606-45587628 CCTGGGCTACGGCATTCCTTGGC No data
Right 1173763771 20:45587646-45587668 GGCACTTGTAGCAAGCTCCTGGG 0: 307
1: 190
2: 139
3: 92
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173763771 Original CRISPR GGCACTTGTAGCAAGCTCCT GGG Intergenic
900395450 1:2451512-2451534 GGCCCTTGGAGCCAGTTCCTGGG - Intronic
900722535 1:4186684-4186706 GGCACTTGCAGCCAGCTCCTGGG + Intergenic
900840792 1:5047106-5047128 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
900847479 1:5115381-5115403 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
901056914 1:6452643-6452665 CGCATTTCTAGCCAGCTCCTGGG + Intronic
901451723 1:9340074-9340096 TGCATTTCCAGCAAGCTCCTGGG + Intronic
902050921 1:13563139-13563161 GGCACTTGAAGCAAGATCCTGGG - Intergenic
902477458 1:16695852-16695874 TGCATTTCTAGCCAGCTCCTGGG - Intergenic
902984457 1:20147175-20147197 GGCATTTCTAACAAGTTCCTGGG - Intronic
903396021 1:23002399-23002421 GGCACTTGAAGCAAGATCCTGGG + Intergenic
903584977 1:24407563-24407585 GGCACCTGTACCCAGCTACTCGG - Intronic
904310048 1:29623128-29623150 GCCAATTGAAGCAAGCACCTTGG - Intergenic
904393964 1:30205651-30205673 GGCACTTGAAGCAAAATCCTGGG - Intergenic
904711639 1:32434606-32434628 AGCACGTGTACCAAGCTCTTGGG - Intergenic
904996476 1:34635409-34635431 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
905060515 1:35135782-35135804 GGCACTTCTAGCAAGCTCCTGGG + Intergenic
905429294 1:37909910-37909932 AGCACTAGAAGCAAGATCCTGGG - Intronic
905499785 1:38427340-38427362 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
906080924 1:43087767-43087789 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
906287179 1:44595073-44595095 TGCATTTCTACCAAGCTCCTAGG - Intronic
906378728 1:45317895-45317917 AGCACTTGAAGCAAGATCCTGGG - Intergenic
906744517 1:48212441-48212463 AGCACTTGTAGCAAGCTCCTGGG + Intergenic
907292638 1:53426555-53426577 GGCACTTGTAGCAAACTCCTGGG - Intergenic
907293608 1:53434505-53434527 GGCACTTGAAGCAAGATCCTGGG - Intergenic
907503562 1:54901312-54901334 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
907521264 1:55024859-55024881 GGCACTTGTAGCAAACTCCTGGG - Intergenic
907543646 1:55240081-55240103 TGCATTTCTAGCAAGCTCCAAGG + Intergenic
908456572 1:64310113-64310135 GGCACTTGCTCCAAACTCCTAGG - Intergenic
908852409 1:68388524-68388546 GGCACATGTAGCAAGCTCCTGGG - Intergenic
908984530 1:70000822-70000844 TGCCCTTGTCACAAGCTCCTAGG + Intronic
909035479 1:70590563-70590585 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
909223647 1:72991235-72991257 AGCACATGTAGCAAGCTCCTGGG + Intergenic
909374167 1:74921175-74921197 GGCACTTGAAGCAAGATCCTGGG - Intergenic
909551014 1:76898225-76898247 AGCACTTGTAGCAAGCTCCTGGG + Intronic
909776687 1:79492014-79492036 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
909788263 1:79642176-79642198 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
910049386 1:82957575-82957597 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
910144126 1:84058674-84058696 GGCACTTGTAGAGAGCTCCTGGG + Intergenic
910799150 1:91128474-91128496 GGTACTTTTTACAAGCTCCTTGG - Intergenic
911071079 1:93832319-93832341 GGCACTTGAAGCAAGATCCTGGG - Intronic
911147982 1:94570310-94570332 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
911510610 1:98804692-98804714 GGCACTTGTAACAAGCTCCTTGG + Intergenic
911759777 1:101601486-101601508 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
911966933 1:104382446-104382468 AGCACTTGAAGCAAGATCCTGGG - Intergenic
912296480 1:108475210-108475232 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
912813570 1:112811698-112811720 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
912815304 1:112823919-112823941 AGCACTCATAGCAAGCTCCTGGG + Intergenic
912987513 1:114449432-114449454 GGCACTTGTGGCACTCTCTTGGG + Intronic
913001882 1:114588803-114588825 GGCACTTGTCTCAAACTCCTGGG + Intronic
913245138 1:116864391-116864413 GGCACTTGAAGCAAGATCCTGGG - Intergenic
914346818 1:146806966-146806988 GGTACTGGCAGCAAGTTCCTAGG - Intergenic
915623818 1:157102331-157102353 TGCACTTCTAACAAGCTCCTAGG + Intergenic
915979027 1:160408692-160408714 GGCACCTGGTGCCAGCTCCTGGG + Intronic
916328864 1:163593280-163593302 AGCACTTGAAGCAAGATCCTGGG - Intergenic
916490353 1:165296931-165296953 TGCATTTGTAACAAGTTCCTTGG + Intronic
917749658 1:178042236-178042258 GGCACTTGAAGCAAGATCCTGGG - Intergenic
917852729 1:179079222-179079244 TGCATTTCTAACAAGCTCCTGGG + Intergenic
917936591 1:179874137-179874159 TGTACTTTTAGCAAGCTCCCAGG - Intronic
918347122 1:183615906-183615928 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
918567666 1:185951751-185951773 GGCACGTGTAGCAAGCTCCTGGG + Intronic
918714400 1:187768948-187768970 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
919476404 1:198037052-198037074 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
919544670 1:198900140-198900162 GGCACTTGTAATAAGCATCTTGG - Intergenic
920427337 1:205888723-205888745 AGCACTTAAAGCAAGATCCTGGG + Intergenic
920766423 1:208838100-208838122 CGCATTTCTAGCAAGCTCCCAGG + Intergenic
920829406 1:209451194-209451216 CGCACATGTAGCAAGCTCCTGGG - Intergenic
920901525 1:210114264-210114286 AGCACTTAAAGCAAGATCCTGGG + Intronic
920964346 1:210689850-210689872 GGCATTTGCAGCAAACTCCCAGG + Intronic
921061155 1:211585640-211585662 TGCATTTCTAACAAGCTCCTAGG + Intergenic
921520135 1:216147806-216147828 AGCACGTGTAGCAAGCTCCTGGG - Intronic
921732968 1:218597244-218597266 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
922048419 1:221968214-221968236 GGCACTTGTAGCAAACTCCTGGG - Intergenic
922154063 1:223027858-223027880 GGCATGTGTAGCAAGCTCCTGGG + Intergenic
922363540 1:224843908-224843930 GGCACTTGAAGCAAGCTCCTGGG + Intergenic
922598979 1:226835526-226835548 AGCACTTGAAGCAAGATCCTGGG - Intergenic
922877088 1:228948494-228948516 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
923075211 1:230603488-230603510 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
923214188 1:231833662-231833684 GGCACTTGTAGCAAGCTCCTGGG + Intronic
923244758 1:232120437-232120459 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
923770731 1:236935706-236935728 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
923962790 1:239103629-239103651 GGCACTTGTAGCAAGCCTCTGGG - Intergenic
924694593 1:246385817-246385839 TGCACTTGTAACAAGCTTCCAGG + Intronic
924896175 1:248339682-248339704 GGCGCTTATAGCAAGCTCCTGGG + Intergenic
1062930760 10:1351007-1351029 GGCACTTGTAGCAAGCTTCTCGG - Intronic
1063106403 10:2996433-2996455 ACCACTTGTAGCAAGCTCCTGGG + Intergenic
1063363173 10:5473370-5473392 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1063618241 10:7620974-7620996 GGCATTTCTAGCAAGTTCCCAGG - Intronic
1064663807 10:17630297-17630319 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1064886989 10:20122612-20122634 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1065437636 10:25718705-25718727 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1065443115 10:25772192-25772214 GGCATGTGTAGCAAGTTCCTGGG + Intergenic
1066103391 10:32137108-32137130 AGCACTTGAAGCAAGATCCTGGG + Intergenic
1066437209 10:35405932-35405954 GGCACTTGAAGCAAGATCCTGGG + Intronic
1067085419 10:43235557-43235579 TGCCTTTTTAGCAAGCTCCTGGG - Intronic
1067310129 10:45105150-45105172 GGCACTGGTCTCAAACTCCTGGG + Intergenic
1067360410 10:45573471-45573493 GGCACCTGAAGCAAGTTCCTGGG - Intronic
1068360779 10:55973459-55973481 GGCACTTGAAATAAGATCCTGGG - Intergenic
1068949649 10:62764410-62764432 AGCATTTTTAGCAAGTTCCTGGG - Intergenic
1069295262 10:66835912-66835934 TGCATTTCTAACAAGCTCCTAGG + Intronic
1070412563 10:76156298-76156320 GGCACTTACAGCAAGCTCACAGG + Intronic
1070570261 10:77635991-77636013 GCAACTTGTAGCAGCCTCCTTGG - Intronic
1070646914 10:78208185-78208207 GGCATTTCTAGCAAGCTCTTAGG - Intergenic
1070723482 10:78772602-78772624 GGCGCTTCCAACAAGCTCCTGGG + Intergenic
1071228361 10:83558093-83558115 TGCATTTTTAACAAGCTCCTTGG + Intergenic
1071306354 10:84302558-84302580 TGCACTTCTAACAAGCTCCCAGG + Intergenic
1071550784 10:86564690-86564712 AGCACTTGAAGCAATATCCTGGG + Intergenic
1071916207 10:90297264-90297286 GGCATGTGTAGCAAGTTCCTGGG - Intergenic
1071983945 10:91032018-91032040 TGCATTTCTAACAAGCTCCTGGG + Intergenic
1072011271 10:91304940-91304962 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1072580266 10:96734471-96734493 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1072741101 10:97910385-97910407 TGCAATTCTAGCAAGCTCCCAGG - Intronic
1072809065 10:98445701-98445723 GTCACTCCTAGCAAGCTCCCTGG - Intronic
1072884531 10:99261849-99261871 GGCACTTGAAGCAAGATCCTGGG - Intergenic
1072951269 10:99848564-99848586 TGCACATGTAACAAGCTCCCAGG - Intronic
1073014025 10:100384004-100384026 AGCACTTGAAGAAAGATCCTGGG - Intergenic
1073221869 10:101881307-101881329 GAGATTTTTAGCAAGCTCCTGGG + Intronic
1073709484 10:106021072-106021094 GGCGCTTGTAGCAAGCTCCTGGG + Intergenic
1073933211 10:108600061-108600083 GGCACTTGAAGCAAGATGCTGGG - Intergenic
1074019034 10:109564624-109564646 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1074740785 10:116482912-116482934 GGCACTTGCAGCAAGCTCCTGGG - Intergenic
1075248704 10:120847107-120847129 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1076462664 10:130657091-130657113 TGCACCTGTAGCAAGGTGCTGGG + Intergenic
1077612190 11:3650194-3650216 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1077679061 11:4222698-4222720 AGCACTTGTAGCAAGCTCCTGGG + Intergenic
1077688497 11:4319339-4319361 AGCACTTGTAGCAAGCTCCTGGG + Intergenic
1077718429 11:4603719-4603741 TGCATTTCTAACAAGCTCCTAGG - Intronic
1077766377 11:5163737-5163759 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1077883363 11:6368072-6368094 GGCACTTGTAGCGAGCTCCTGGG - Intergenic
1079230519 11:18645288-18645310 GGCACTTGCAGCAAGCTCCTGGG - Intergenic
1079672565 11:23187392-23187414 AGCACGTGTAGCAAGCTCCTGGG + Intergenic
1079727067 11:23890635-23890657 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1079847684 11:25490672-25490694 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1080027910 11:27632537-27632559 GGCACTTGTGGCAAGCTCCTGGG + Intergenic
1080103123 11:28482720-28482742 TGCATTTCTAGCAAGCTCCCAGG - Intergenic
1080227363 11:29975667-29975689 GGCACTTGTAGCAAACTCGTGGG - Intergenic
1080994444 11:37582073-37582095 GGCACTTGAAGCAAGATCTTGGG + Intergenic
1081857591 11:46313382-46313404 TGCATTTCTAACAAGCTCCTAGG - Intronic
1083534416 11:63455168-63455190 ATCACTTGTAGCAAGCTCCTGGG - Intergenic
1084232309 11:67761942-67761964 GGCACTTGTGGCAAGCTCCTGGG - Intergenic
1084245593 11:67854861-67854883 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1084355559 11:68635970-68635992 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1084613268 11:70217730-70217752 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1084827095 11:71739717-71739739 GTCACTTGTAGCAAGCTCCTGGG - Intergenic
1085570198 11:77552191-77552213 AGCACTTGGAGCAAGATCCTGGG - Intronic
1085988021 11:81808473-81808495 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1086005025 11:82027479-82027501 GGCACTTGTAACAAGCTCCTGGG - Intergenic
1086134829 11:83435034-83435056 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1086136263 11:83446356-83446378 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1086172159 11:83848896-83848918 GGCACATTTAGCCATCTCCTGGG + Intronic
1086550218 11:88045450-88045472 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1086808651 11:91276295-91276317 GGAAGTTGTAGCATGCTACTAGG - Intergenic
1086974882 11:93120210-93120232 TGCATTTGTAACAAGCTCCCGGG + Intergenic
1087099105 11:94347978-94348000 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1087099648 11:94351911-94351933 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1087127824 11:94643875-94643897 GGCACTTGTAGCGAGCTCCTGGG - Intergenic
1087196923 11:95311781-95311803 GGCACTTGTAGAGAGCTCCTGGG - Intergenic
1087314681 11:96590183-96590205 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1087839535 11:102907532-102907554 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1087971041 11:104484530-104484552 TGAATTTCTAGCAAGCTCCTAGG - Intergenic
1088554967 11:111052451-111052473 AGTACTTGTAGCAAGCTCCTCGG - Intergenic
1088751229 11:112843795-112843817 TGCATTTCTAGCAAGCTCCCAGG + Intergenic
1089288771 11:117424981-117425003 TGCATTTGCAACAAGCTCCTAGG + Intergenic
1089349100 11:117811540-117811562 AGCACTTGTAGTAAGCTCCTGGG - Intronic
1089471048 11:118720452-118720474 GGCACTTGTAGCAAGTTCCTGGG + Intergenic
1089732940 11:120530739-120530761 GGAACCTGTAGCAGGCCCCTTGG - Intronic
1089867043 11:121641377-121641399 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1089987689 11:122829381-122829403 GGCACTTGTAGGAAGCTCCTGGG - Intergenic
1090107593 11:123869051-123869073 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1090526802 11:127546185-127546207 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1090546483 11:127772529-127772551 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1090850590 11:130567816-130567838 CGCACATGTAGCAAGCTCCTGGG + Intergenic
1090926932 11:131257942-131257964 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1091026287 11:132144257-132144279 TGCATTTTTAGCAAGCTCCCAGG - Intronic
1091652679 12:2321389-2321411 GGCACTTGTACCCATCTCGTAGG + Intronic
1091886523 12:4020789-4020811 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1092416171 12:8291992-8292014 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1092592748 12:9966520-9966542 GGCACTTTTAGCAAGCTCCTGGG + Intronic
1092626741 12:10336382-10336404 AGCATGTGTAGCAAGCTCCTGGG + Intergenic
1092664149 12:10775730-10775752 GGTACTTTTAGGAATCTCCTTGG + Intergenic
1092739317 12:11613148-11613170 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1092789715 12:12060651-12060673 GGCACTTGTAGCAAGCTCCTCGG - Intronic
1092924848 12:13263424-13263446 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1093024337 12:14232838-14232860 GGCACTTGAAGCAAGATCCTGGG - Intergenic
1093268004 12:17025157-17025179 AGCATGTGTAGCAAGCTCCTGGG + Intergenic
1093321981 12:17723731-17723753 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1093358441 12:18197209-18197231 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1093578822 12:20765635-20765657 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1093584512 12:20820455-20820477 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1093812830 12:23509465-23509487 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1093951076 12:25165406-25165428 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1094161264 12:27393407-27393429 TGCATTTCTAGCAAGCTCCCAGG + Intronic
1094316046 12:29138455-29138477 GGCATGTGTAGCAAGCTCCTGGG + Intergenic
1094400681 12:30058236-30058258 GGCAGTTGGGGCAAGCTCCTGGG - Intergenic
1094825760 12:34267896-34267918 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1095637659 12:44452055-44452077 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1095999020 12:48113585-48113607 GACACTTGAAGCAAGATCCTGGG + Intronic
1097398593 12:59104098-59104120 GGCACTTGTGGCAAGTTCCTGGG - Intergenic
1098402254 12:70087659-70087681 GGCACGCGTAGCAAGCTCCTGGG - Intergenic
1098653822 12:73005417-73005439 GGCACTTGTAGCAGGCTCCTGGG + Intergenic
1098919911 12:76293718-76293740 GGCACTTGAAGCAAGCTCCTTGG - Intergenic
1099019718 12:77388580-77388602 TGCATTTCTAACAAGCTCCTAGG - Intergenic
1099047302 12:77737427-77737449 CGTACTTGGAACAAGCTCCTAGG + Intergenic
1099188720 12:79542118-79542140 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1099292096 12:80786530-80786552 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1099836093 12:87910844-87910866 GACACTTGTAGCAAGCTCCTGGG + Intergenic
1100908601 12:99332163-99332185 TGCACTTCTAATAAGCTCCTAGG - Intronic
1100940302 12:99717446-99717468 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1101252350 12:102948773-102948795 GGCTCTTTTAGCAAGCTACCTGG - Intronic
1101278393 12:103226133-103226155 AGCACTTGTAGCAAGCTCCTGGG + Intergenic
1101400102 12:104379662-104379684 GGCATTTCTAACAAGCTCCCAGG + Intergenic
1102116737 12:110408715-110408737 AGCACTTGAAGCAAGATCCTGGG + Intergenic
1103130530 12:118464595-118464617 GGCATTTGTAGCAACCTGCATGG - Intergenic
1104023272 12:125008081-125008103 TGCATTTCTGGCAAGCTCCTGGG + Intronic
1106284644 13:28308170-28308192 GGCATTTCTAGCCAGTTCCTAGG + Intronic
1106689955 13:32104349-32104371 TGCATTTCTAGCAAGCTCCCAGG - Intronic
1107102564 13:36609879-36609901 GGCACTTCTAACAAGCTCCCAGG + Intergenic
1107220290 13:37972629-37972651 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1108202701 13:48058656-48058678 GGCACTTATAGCAAGCTCCTGGG - Intronic
1108282060 13:48870576-48870598 GGCACTTGGAGCAAGATCCTGGG + Intergenic
1108803866 13:54131144-54131166 GGCACTTGTAGCAAGCCCCTGGG + Intergenic
1108952942 13:56115871-56115893 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1109302785 13:60606357-60606379 TGCATTTCTAGCAAGCTCCCGGG - Intergenic
1109499299 13:63215382-63215404 GGCACTTATAGCAAGCTCCTAGG - Intergenic
1110572616 13:77022840-77022862 GGCTCTGGAACCAAGCTCCTTGG + Intronic
1110765481 13:79276394-79276416 GGCACTTGTAGGAAGCTCCTGGG - Intergenic
1110845347 13:80185931-80185953 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1110978496 13:81868433-81868455 AGCACTTGTAGCAAGCTTCTGGG - Intergenic
1111126039 13:83911734-83911756 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1111362102 13:87189880-87189902 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1111458835 13:88516278-88516300 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
1111630445 13:90841699-90841721 GGCATGTGTAGCAAGCTCCTGGG - Intergenic
1111631697 13:90852040-90852062 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1112128244 13:96494056-96494078 TGTAATTGTAGCAAGCTCCAGGG - Intronic
1112236833 13:97644575-97644597 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1112786485 13:102957171-102957193 TGCATTTCTAACAAGCTCCTGGG + Intergenic
1112889312 13:104211510-104211532 GGCACTTGTAGCAAGCTCTTGGG + Intergenic
1113324342 13:109267606-109267628 GGCACTTGCAGCAAGCTCCTGGG - Intergenic
1113979342 13:114260453-114260475 TGCACTTCTAGCAGGCTTCTAGG - Intronic
1114221682 14:20702842-20702864 AGCACTTGAAGCAAGATCCTGGG - Intergenic
1115240597 14:31248796-31248818 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1115808894 14:37083701-37083723 TGCATTTCTAGCAAGCTCCCAGG - Intronic
1115904813 14:38193050-38193072 GGCAAGTGTAGCAAGCTCCTGGG - Intergenic
1116051377 14:39807559-39807581 TGTACTTCTAACAAGCTCCTAGG - Intergenic
1116179682 14:41518202-41518224 AGCACGTGTAGCAAGCTCCTGGG - Intergenic
1116490581 14:45498837-45498859 GGCACTTGTAGCAAGCTTCTGGG + Intergenic
1116573460 14:46546186-46546208 GGCACTTGTAGCAAGCTCTTGGG - Intergenic
1116702400 14:48258835-48258857 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1116703284 14:48265827-48265849 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1117174159 14:53130655-53130677 GGCACTTGAAGCAAGATCCTGGG - Intronic
1117801189 14:59446315-59446337 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1118894633 14:69935649-69935671 CCCACATGTAGCAAGCTCCTTGG - Intronic
1119022438 14:71126585-71126607 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1119317207 14:73705750-73705772 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1119953737 14:78772707-78772729 TGCATTTCTAGCAAGCTCCCAGG + Intronic
1120251388 14:82064534-82064556 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1120438046 14:84503658-84503680 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1120539553 14:85736426-85736448 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1120618261 14:86733608-86733630 GGCACTTGTTGCAAGCTCTTGGG - Intergenic
1120659950 14:87238490-87238512 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1121193297 14:92048162-92048184 GGCACTTGAAGCAAGATCCTGGG + Exonic
1121230574 14:92354702-92354724 TGCACTTCTAACAAGCTCCCAGG + Intronic
1121703656 14:95975207-95975229 GACACTTGTAGCAAGCTCCTGGG - Intergenic
1121980577 14:98450577-98450599 TGCACTTGTAGCAAGCTCCTAGG + Intergenic
1122381318 14:101309124-101309146 AGCACTTGAAGCAAGATCCTGGG + Intergenic
1122430653 14:101638699-101638721 GGACCTTGTAACCAGCTCCTTGG - Intergenic
1123882488 15:24689032-24689054 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1124038403 15:26078050-26078072 TGCACTTCTAGCAAGCTCCTAGG + Intergenic
1125131511 15:36289094-36289116 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
1125213212 15:37239648-37239670 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1125629226 15:41133767-41133789 GGCACTTGAAACAAGATCCTGGG - Intergenic
1125849096 15:42886785-42886807 GGCACTTGAAGCAAGATCCTGGG - Intronic
1126530149 15:49702589-49702611 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1126843753 15:52740846-52740868 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1126912400 15:53430285-53430307 GGCACTTGTAGGAAGCTCCTGGG + Intergenic
1127464680 15:59232373-59232395 TGCATTTGTAGCCAGCTCCCTGG + Intronic
1128182392 15:65615553-65615575 GGCACCTGTAGTCAGCTGCTTGG + Intronic
1129044594 15:72722808-72722830 GGTATATGTAGCAAACTCCTAGG - Exonic
1129259441 15:74356188-74356210 AGCACTTGAAGCAAGATCCTGGG - Intronic
1129443148 15:75597017-75597039 GGCACTTAAAACATGCTCCTTGG + Intergenic
1130724589 15:86425712-86425734 ATCACTTTTAGAAAGCTCCTTGG - Intronic
1130882159 15:88064697-88064719 GGCTCTTCTTGAAAGCTCCTTGG - Intronic
1131295002 15:91140027-91140049 TGCATTTCTAGCAAGCTCCCAGG - Intronic
1131447754 15:92513770-92513792 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1131684186 15:94753033-94753055 AGCACTTGTAGCAAGCTCCTGGG - Intergenic
1131684713 15:94756736-94756758 GGCACTTGTACCAAGCTCCTGGG - Intergenic
1131725346 15:95216622-95216644 TGCATTTTTAACAAGCTCCTAGG - Intergenic
1131882511 15:96875277-96875299 GGCATGTGTAGCAAGCTCCTTGG + Intergenic
1132263020 15:100442546-100442568 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1132340418 15:101074796-101074818 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1133097274 16:3456276-3456298 TGCATTTTTAGCAAGCTCCCAGG + Intronic
1133387455 16:5381480-5381502 TGCATTTCTAGCAAGCTCCCTGG + Intergenic
1133651399 16:7816963-7816985 GGCACTTGTAGCAAGCGCCTAGG - Intergenic
1133765731 16:8836466-8836488 AGCACGTGTAGCAAGCTCCTGGG + Intronic
1133766758 16:8843533-8843555 GGCACGTGTAGCAAGCTCCTGGG + Intronic
1133869538 16:9674566-9674588 GGCACTTGTAGCAATCTCCTGGG + Intronic
1133911516 16:10070334-10070356 TGCACTTCTAAGAAGCTCCTGGG - Intronic
1133938181 16:10285414-10285436 AGCACTTGAAGCAAGCTCCTGGG - Intergenic
1134094677 16:11411574-11411596 GGCACCAGGAGCAAGCTTCTTGG + Intronic
1135025409 16:18995582-18995604 AGCACTTAGAGCAAGATCCTGGG + Intronic
1135060027 16:19263512-19263534 GGCACCTGTACCCAGCTACTTGG + Intronic
1136529956 16:30861416-30861438 GGCACTTGAAGCAAGATCCTGGG - Intronic
1137758825 16:50924223-50924245 TGCATTTTTAGCAAGCTCCCAGG + Intergenic
1138759097 16:59521081-59521103 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1138804955 16:60081092-60081114 GGCACGTGTAGCAAGCTCCTAGG - Intergenic
1139033992 16:62920871-62920893 TGCATTTCTAGCAAGCTCCCAGG + Intergenic
1139039231 16:62982596-62982618 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1139230596 16:65278702-65278724 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
1139943716 16:70624234-70624256 GGCACGTGTAGCAAGCTCCTGGG + Intronic
1139987163 16:70908304-70908326 GGTACTGGCAGCAAGTTCCTAGG + Exonic
1141128395 16:81417469-81417491 GGCATTTCTCACAAGCTCCTGGG - Intergenic
1141332918 16:83128315-83128337 TGCATTTCTAGCAAGCTCCCAGG - Intronic
1141757333 16:86000050-86000072 GGCATTTTTAACAAGCTCCCAGG + Intergenic
1141865198 16:86745474-86745496 GGCACTTGTAGCAAGGTCCTTGG + Intergenic
1143386639 17:6534910-6534932 GGTACTTGCAGCCAACTCCTGGG - Intronic
1143925466 17:10365501-10365523 GGCATTTCTAGCAAGTTCCCAGG + Intronic
1143970194 17:10789813-10789835 TGCATTTCTAACAAGCTCCTAGG + Intergenic
1144104677 17:11974155-11974177 GGCACTTGTAGTAAGCTCCTGGG - Intergenic
1145080662 17:19891912-19891934 GGCACTTGAAGCAAGATCCTGGG + Intergenic
1146102235 17:29994364-29994386 GGCACTTTTGGCAAGCACTTTGG - Intronic
1146597902 17:34185534-34185556 CGCACATGTAGCAAGCTCCTGGG - Intergenic
1149319573 17:55470059-55470081 GGCACTTGAAGCAAGATCCTGGG - Intergenic
1149401203 17:56297581-56297603 GTCACTGGTAGCAACCTCATGGG + Intronic
1149493714 17:57103414-57103436 TGCATTTCTAGCAAGGTCCTAGG + Intronic
1150212166 17:63447197-63447219 GCCAGATGTAGCAAGCGCCTAGG + Intergenic
1151622494 17:75254834-75254856 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1151839750 17:76609404-76609426 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1152048577 17:77955416-77955438 TGCCCTTCTAACAAGCTCCTAGG + Intergenic
1153269406 18:3304940-3304962 GGCATTTCTGGCAAGCTCCCAGG + Intergenic
1153626828 18:7029238-7029260 TGCACTTCTAGCAAGCTCCCAGG + Intronic
1155028300 18:21962096-21962118 TGCATTTGTAACAAGCTCCCAGG + Intergenic
1155173824 18:23286300-23286322 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1155270435 18:24136636-24136658 GGCATTTTTAACAAGCTCCTGGG + Intergenic
1155416012 18:25600641-25600663 GGTACTTCAAGCAATCTCCTCGG + Intergenic
1155697011 18:28696550-28696572 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1155935067 18:31745163-31745185 GGCACTTGAAGCAAGGTAGTCGG - Intergenic
1155941553 18:31806065-31806087 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1155962000 18:32002867-32002889 GGCACTTGAAGCAAAATCCTGGG - Intergenic
1156237365 18:35218029-35218051 AGCACTTGTAGCAAGCTCCTGGG - Intergenic
1156251926 18:35359758-35359780 GGCACTCGTAGCAAGCTCCTGGG + Intergenic
1156302253 18:35846154-35846176 AGCACTTGTAGCGAGCTCCTGGG - Intergenic
1156924048 18:42555940-42555962 GGCACTTGTAGCAAGCTCCAGGG + Intergenic
1156938536 18:42738912-42738934 GGCACTTGTAGCAAGCTCCAGGG - Intergenic
1156958184 18:42993134-42993156 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1157247233 18:46065415-46065437 GGCACTTGTACTCAGCTACTTGG - Intronic
1157744004 18:50118845-50118867 GGCATTTCTAACAAGCTCCCAGG + Intronic
1157906386 18:51573488-51573510 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1158394639 18:57070076-57070098 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1158576691 18:58644431-58644453 AGCACTTGAAGCAAGCTCCTGGG + Intergenic
1159164472 18:64683901-64683923 GGCTCTTGTAGCAAGTTCCTGGG - Intergenic
1159929222 18:74294693-74294715 AGTACTTGAAGCAAGATCCTGGG - Intergenic
1160179838 18:76624535-76624557 TGCATTTTTAGCAAGCTCCCAGG - Intergenic
1161661723 19:5550731-5550753 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1161711221 19:5849350-5849372 AAAACTTGTAGCAAGCTCCTGGG - Intronic
1161712044 19:5854370-5854392 GGCACTTGAAGCAAGATCCTGGG - Intergenic
1164080812 19:21860062-21860084 GGCACTTGAAGCAAGATGCTGGG - Intergenic
1164202499 19:23030270-23030292 AGCACTTGAAGTAAGATCCTGGG + Intergenic
1164258767 19:23551524-23551546 GGCAATTGAAGCAAGATCCTGGG - Intronic
1164459225 19:28433312-28433334 GGCACTTGTAGCAAGCTTCTGGG + Intergenic
1165249242 19:34516254-34516276 AGCACTTGAAGCAAGCTCCTGGG - Intergenic
1165372307 19:35416692-35416714 GGCACTTGTGCCAATCTGCTAGG - Intergenic
1165497000 19:36158867-36158889 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1165510313 19:36262933-36262955 GGCACTTATAGCAAGCTCCTGGG + Intergenic
1165835363 19:38751871-38751893 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1166498936 19:43326952-43326974 GGCACGTGTAGCAAGCGCCTGGG + Intergenic
1166905788 19:46107499-46107521 AGCACTTGAAGCAAGATCCTGGG + Intergenic
1166927136 19:46276775-46276797 AGCACTTGTAGCAAGTTCCTGGG + Intergenic
1167046598 19:47053197-47053219 AGCATGTGTAGCAAGTTCCTGGG + Intergenic
1167221297 19:48200370-48200392 TGCATTTCTAACAAGCTCCTAGG - Intronic
1167902154 19:52630032-52630054 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1168051645 19:53833870-53833892 AGCATGTGTAGCAAGTTCCTGGG - Intergenic
1168212113 19:54898335-54898357 AGTACTTGTAGCAAGCTCCTGGG + Intergenic
1168227981 19:55010233-55010255 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1168636960 19:58003823-58003845 GGCACCTGTACCCAGCTACTTGG + Intronic
1202711478 1_KI270714v1_random:21678-21700 TGCATTTCTAGCCAGCTCCTGGG - Intergenic
925990314 2:9249510-9249532 GGCAATCTTTGCAAGCTCCTAGG - Intronic
926407775 2:12572017-12572039 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
926464088 2:13167440-13167462 GGCATGTGTAGCAAGCTCCTGGG + Intergenic
926471429 2:13264038-13264060 AGCACTTGCAGCAAGTTTCTAGG - Intergenic
926566984 2:14487040-14487062 GACACTTCTAATAAGCTCCTCGG + Intergenic
928770181 2:34696113-34696135 GGCACTTGTAGCAAGCTCTTGGG - Intergenic
928778309 2:34791968-34791990 AGCACTTGTAGCAAGCTCCTGGG - Intergenic
928827651 2:35440547-35440569 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
928857174 2:35815341-35815363 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
928928568 2:36601296-36601318 GGCACTTGTAGTAAGCTCCTGGG - Intronic
929076669 2:38084215-38084237 AGCACTTGTAGCAAGCTCCTAGG + Intronic
929139429 2:38654179-38654201 GGCAAATGTGACAAGCTCCTGGG - Intergenic
929440491 2:41962505-41962527 TGCAATTCTAGCAAGTTCCTAGG - Intergenic
929684524 2:44022493-44022515 GGCACTGGAAGCAAGATCCTGGG + Intergenic
929793060 2:45037885-45037907 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
930099075 2:47589117-47589139 GGCACTTGAAGCAACATCCTGGG + Intergenic
930487359 2:52025563-52025585 GGCACTTGTAGCAAGCTCCTAGG + Intergenic
930955103 2:57195227-57195249 GGCATTTGTAGCAAGCTCCTGGG - Intergenic
930958385 2:57231149-57231171 AGCACTTGTAGCAAGCTCCTGGG - Intergenic
931026388 2:58116865-58116887 GGCACTTGTAGCAAGCTCCTGGG + Intronic
931042619 2:58315957-58315979 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
931236945 2:60419872-60419894 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
931608921 2:64078619-64078641 GGCACTTGTGGCAAGCTCCTGGG + Intergenic
931625781 2:64254789-64254811 GGCACATGTAGCAAGCTCATGGG - Intergenic
931850429 2:66246192-66246214 GGCACTTGTAGCAAGCTCCTTGG - Intergenic
931948261 2:67333858-67333880 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
932159455 2:69447101-69447123 AGCACTTGTAGCAAGCTCCTGGG + Intergenic
932210938 2:69929514-69929536 GGCACTGATAGAAAGCACCTGGG - Intronic
932295858 2:70622888-70622910 AGCACTTGTAGCAAGCTCCTGGG - Intronic
932358814 2:71088493-71088515 GGCACTTGCAGCAAACTCCTGGG + Intergenic
932367643 2:71163133-71163155 GGCATGTGTAGCAAGCTCCTGGG + Intergenic
932482992 2:72060383-72060405 TGCATTTATAACAAGCTCCTAGG + Intergenic
933013096 2:77090637-77090659 GGCACTTGTAGCAAGCTCCTGGG - Intronic
933079276 2:77967370-77967392 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
933163736 2:79053648-79053670 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
933179764 2:79215268-79215290 GGCACTTGTAGCAAGCTCCTGGG + Intronic
933256568 2:80087736-80087758 TGCATTTGTAACAAGCTCCAAGG + Intronic
933329516 2:80877916-80877938 GGCACATGTAGCAAGCTCCTGGG + Intergenic
933539772 2:83624740-83624762 TGCATTTTTAACAAGCTCCTGGG - Intergenic
933552389 2:83792359-83792381 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
934141267 2:89050180-89050202 AGCACTTGAAGCAAGATCCCGGG - Intergenic
934227973 2:90150364-90150386 AGCACTTGAAGCAAGATCCCAGG + Intergenic
934567969 2:95351044-95351066 TGCATTTCTACCAAGCTCCTGGG - Intronic
935382333 2:102465354-102465376 AGCACTGGTATCAAACTCCTGGG + Intergenic
935658275 2:105443449-105443471 GGCACATGGAGGAAGCTCCATGG - Intergenic
936017571 2:108971318-108971340 GGCATTTCTAACGAGCTCCTGGG - Intronic
936615224 2:114041446-114041468 TGCATTTCTAGCAAGCTCCCAGG + Intergenic
936794289 2:116187718-116187740 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
936858303 2:116986593-116986615 GGCATTTGTAGCAACCTACACGG + Intergenic
936870797 2:117132580-117132602 AGCACTTGAAGCAAGATCCTGGG - Intergenic
936883339 2:117281002-117281024 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
937155935 2:119719003-119719025 TGCATTTCTAACAAGCTCCTGGG + Intergenic
938890982 2:135705508-135705530 GGCGCTTGTAGTTAGCTACTCGG + Intronic
939083134 2:137686393-137686415 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
939307417 2:140428400-140428422 GGCACTTGTAGCAAGCTCCTGGG - Intronic
939387703 2:141522117-141522139 TGCATTTCTAGCAAGTTCCTAGG - Intronic
939460729 2:142493282-142493304 AGCACTTGAAGCAAGTTCCTGGG + Intergenic
940107353 2:150114871-150114893 CGCACTTGTAGCAAGCTCCTGGG - Intergenic
940182944 2:150955300-150955322 GGCACTTGAAGCAAGATCCTGGG - Intergenic
940508787 2:154586687-154586709 AGCACTTGTAGCAAGCTCCGGGG + Intergenic
940530193 2:154869582-154869604 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
940675799 2:156723518-156723540 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
940726434 2:157341552-157341574 AGCATTTGAAGCAAGATCCTGGG + Intergenic
941340404 2:164298116-164298138 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
941456184 2:165713945-165713967 GGTATGTGTAGCAAGTTCCTGGG + Intergenic
941935886 2:170981088-170981110 GGCACTTGTAGCAAGCTTCTGGG + Intergenic
942097090 2:172543999-172544021 GGCACTTGTAGCAAGCTTCTGGG - Intergenic
942519350 2:176787101-176787123 GGACCTCATAGCAAGCTCCTCGG + Intergenic
942730287 2:179055205-179055227 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
943412927 2:187563928-187563950 GGCACTTGTAGCAAGCTCCTGGG + Intronic
943421580 2:187673927-187673949 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
943461188 2:188172654-188172676 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
943789104 2:191911688-191911710 GGCACTAGTACAAACCTCCTAGG - Intergenic
943806655 2:192132684-192132706 GGCACTTGTAGCAAGCTCCTGGG - Intronic
943835407 2:192509741-192509763 AGCACTTGTAGCAAGCTCCTGGG - Intergenic
943865349 2:192920320-192920342 AGCACTTGTAGCAAGCTTCTGGG - Intergenic
943951283 2:194134328-194134350 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
944251038 2:197580373-197580395 AGCACTTGAAGCAAGATCCTGGG - Intronic
944394144 2:199249186-199249208 AGCACGTGTAGCCAGCTCCTGGG - Intergenic
944876127 2:203965366-203965388 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
945153099 2:206810307-206810329 AGCACATTTAGCAAGCTCCTGGG + Intergenic
945301480 2:208219686-208219708 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
945361653 2:208901501-208901523 GGCACTTGTAGGAAGCTCCTGGG - Intergenic
945376105 2:209080332-209080354 GGCACTTGTAGCAAGCTTCTGGG - Intergenic
945394305 2:209301484-209301506 GGCATGTGTAGCAAGTTCCTGGG - Intergenic
945858123 2:215091849-215091871 GGCACTTGAAGCAAGATCCTGGG - Intronic
945938322 2:215924632-215924654 GGCAAGTGTAGCAAGCTCCTGGG - Intergenic
946188872 2:217996720-217996742 GGCTCTTGCAGCAGCCTCCTGGG + Intronic
946215026 2:218177481-218177503 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
946641648 2:221790167-221790189 GGCATTTCTAATAAGCTCCTGGG + Intergenic
946781040 2:223193290-223193312 GGCACTTGTAGCAAGCTCCTGGG + Intronic
946871752 2:224091300-224091322 AGCACTTGTAGCAAGCTCCCGGG + Intergenic
946886502 2:224227551-224227573 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
946893278 2:224298936-224298958 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
946918986 2:224558600-224558622 TGCACTTCTAACAAGTTCCTAGG - Intronic
947856120 2:233325795-233325817 GGCACTTCTCTCAAGCTCCCTGG - Intronic
948390689 2:237609216-237609238 GGCACTTGTAGCAAGTTCCTGGG - Intergenic
1168943275 20:1731192-1731214 GGCACTTAAAGCAAGATCCTGGG + Intergenic
1169748389 20:8965960-8965982 TGCACTTGTAACAAGTTCCCTGG - Intronic
1170122780 20:12928151-12928173 GGGACTTCTGGCAAGCTCCCTGG + Intergenic
1170306828 20:14947678-14947700 TGCATTTCTAGCAAGCTCCCAGG + Intronic
1170325483 20:15151283-15151305 AGCACTTGTAGCAAGCTCCTGGG + Intronic
1170784969 20:19459981-19460003 TGCATTTCTAACAAGCTCCTAGG + Intronic
1170820697 20:19754595-19754617 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1172052155 20:32126249-32126271 TGCATTTCTAACAAGCTCCTAGG - Intronic
1172192760 20:33071856-33071878 GGCACTTCTTCCAAGCTCATGGG + Intronic
1173101916 20:40095609-40095631 GGCATGTGTAGCAAGCTCCTGGG - Intergenic
1173118876 20:40271319-40271341 GGCACTTGTAGCAATTTCCTGGG - Intergenic
1173763771 20:45587646-45587668 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1174311483 20:49658781-49658803 TGCACTTGTAACAAGCTCGCAGG + Intronic
1175104579 20:56605540-56605562 TGCATTTCTAGCAAGCTCCAGGG - Intergenic
1175200232 20:57271785-57271807 TGCACTTCTAACTAGCTCCTGGG + Intergenic
1175549630 20:59808734-59808756 TGCATTTCTAGCAAGCTTCTAGG + Intronic
1175715070 20:61249919-61249941 TGCATTTTTAACAAGCTCCTGGG + Intergenic
1177031168 21:15983241-15983263 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1177100628 21:16894437-16894459 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1177102678 21:16916249-16916271 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1177119572 21:17123754-17123776 AGCCCTTGTAGCAAGCTCCTGGG - Intergenic
1177216226 21:18132794-18132816 GGCATTTGTTGCACTCTCCTTGG + Intronic
1177840740 21:26231489-26231511 AGAGCTTGTAGCAAGCTCCTGGG + Intergenic
1178001205 21:28163475-28163497 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1178400283 21:32279420-32279442 TGCATTTCTAACAAGCTCCTAGG + Intergenic
1178583538 21:33855291-33855313 GGCATCTCTAGCAAGCTCCTAGG + Intronic
1178601409 21:33997923-33997945 TGCATTTCTAGCAAGCTCCCAGG - Intergenic
1179015277 21:37590460-37590482 GGCACTTGTAGCATGCTCCCGGG + Intergenic
1179053154 21:37906564-37906586 TGCATTTGTAGCCAGCTCCCTGG + Intronic
1179231418 21:39507048-39507070 GGCACTTGTTGCAAAATCCAGGG - Intronic
1179387561 21:40957211-40957233 GGCATGTGTAGCAAGCTCCTGGG - Intergenic
1179650362 21:42804476-42804498 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1181565472 22:23734318-23734340 TGCATTTCTAGCAAGTTCCTGGG + Intergenic
1182732279 22:32505038-32505060 GGCGCGTGTAGCAAGCTCCTGGG - Intergenic
1183155929 22:36075479-36075501 GGATCTTGTACCAAGTTCCTAGG - Intergenic
1183187837 22:36302550-36302572 GGCCCTTCTAGCACGCACCTTGG + Exonic
1183635667 22:39060965-39060987 GGCACTTGAAGCAAGATCCTGGG + Intronic
1184078889 22:42203805-42203827 GGCAGTTGTAGCAAGCACAGAGG + Intronic
1184335877 22:43852836-43852858 GGAAGTCGTAGCGAGCTCCTGGG - Intronic
1184402002 22:44279841-44279863 TGCATTTATAGCAAGTTCCTGGG - Intronic
949190392 3:1243261-1243283 GGCACTTGTAGCAAGCTCCTGGG + Intronic
949671158 3:6399940-6399962 AGCACTTGTAGCAAGCTCCTGGG - Intergenic
949827446 3:8179277-8179299 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
950091906 3:10301709-10301731 TGCAGTTGTAGCAAGCTCCCAGG - Intronic
950926499 3:16746578-16746600 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
951298806 3:20970961-20970983 GGCACTTGTAGCAACCTCCTTGG + Intergenic
951316312 3:21192648-21192670 GACACTTGTAGCAAGCTCCTGGG + Intergenic
951332323 3:21382012-21382034 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
951599734 3:24360369-24360391 TGCATTTCTAACAAGCTCCTAGG - Intronic
951762791 3:26163819-26163841 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
951888973 3:27551577-27551599 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
952308071 3:32162765-32162787 GGTGCATGTTGCAAGCTCCTGGG + Intronic
952343557 3:32464859-32464881 GGCACTTGTAGCAAGCTCCTGGG + Intronic
952663453 3:35877774-35877796 GGCTCTTGTAGAAAGCTCCTGGG + Intergenic
952896052 3:38079729-38079751 GGCACTCGTAGCAAGCTCCTGGG + Intronic
953077130 3:39581249-39581271 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
953177196 3:40563240-40563262 GGCACTTGTAGCAAGCTCCTGGG - Intronic
953599436 3:44348472-44348494 AGCACTTGAAGCAAGATCCTGGG + Intronic
953825696 3:46249740-46249762 GGCACTTGTAGCAAGCTCCTCGG + Intronic
953841160 3:46391187-46391209 GGCACTTGAAGGAAGATCCTGGG + Intergenic
954596737 3:51831298-51831320 GGCCCTTGGAGCACTCTCCTTGG + Intergenic
954969264 3:54637932-54637954 GGCATGTGTAGCAAGTTCCTGGG + Intronic
955253369 3:57305939-57305961 GGCACTTGTAGCAAGCTCCTGGG - Intronic
956156033 3:66298043-66298065 TGCATTTCTAGCAAGTTCCTAGG - Intronic
956521249 3:70106646-70106668 TGCATTTGTAACAAGCTCCCAGG + Intergenic
956548985 3:70438312-70438334 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
956709221 3:72025249-72025271 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
957059896 3:75473481-75473503 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
957155114 3:76536101-76536123 GGCATTTGAGGCAAGGTCCTGGG + Intronic
957295238 3:78326063-78326085 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
957317309 3:78586596-78586618 GGCATATGTAGCAAGCTCCTGGG + Intergenic
957985691 3:87571617-87571639 GGCACTTGAAGCAAGATCCTGGG - Intergenic
958421958 3:93940061-93940083 GGCACTTGAAGCAAGATCCTGGG - Intronic
958676810 3:97276434-97276456 AGTACTTGTAGCAAGCTCCTGGG + Intronic
958751003 3:98193260-98193282 AGCACTTGAAGTAAGATCCTGGG - Intronic
959288348 3:104443368-104443390 GGCACGTGTAGCAAGCTCTTGGG + Intergenic
959485771 3:106926179-106926201 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
959543692 3:107570091-107570113 AGCACTTGAAGCAAGATCCTGGG + Intronic
959972264 3:112421014-112421036 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
960282874 3:115796955-115796977 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
960310111 3:116108768-116108790 GGCACTTGTAGCAAGCTCCTGGG + Intronic
961164759 3:124756002-124756024 GGTACGTGTAGCAAGCTCCTGGG + Intergenic
961293513 3:125865964-125865986 GGCACTAGTAGCAAGCTCCTGGG - Intergenic
961711622 3:128832641-128832663 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
961730590 3:128961966-128961988 GGCACTTGTAGCAAGCTCCTGGG - Intronic
961881050 3:130061533-130061555 GACACTTGTAGCAAGCTCCTGGG - Intergenic
961893711 3:130150589-130150611 GGCACTTGTAGCAAGCTTCTGGG + Intergenic
962022184 3:131512557-131512579 AGCACTTAAAGCAAGATCCTGGG + Intergenic
962205569 3:133431389-133431411 GGCACTTGAAGCAAGCTCCTGGG - Intronic
962474090 3:135740602-135740624 GGAAATTGCAGCATGCTCCTTGG - Intergenic
962660636 3:137597734-137597756 GGCACCTTTAGCAAGCTCCTGGG - Intergenic
963058626 3:141207224-141207246 GGCACTTGTAGGAAGCTCCTGGG - Intergenic
963111837 3:141694736-141694758 AGCACTTGAAGCAAGATCCTGGG + Intergenic
963267335 3:143252550-143252572 TGCATTTGTAGCCAGCTCCCAGG - Intergenic
963425220 3:145115240-145115262 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
963456658 3:145554625-145554647 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
963468617 3:145712658-145712680 AACACTTGTAGCAAGCTCCTAGG - Intergenic
963520452 3:146355808-146355830 AGCACTTGTAGCAAGCTCCTAGG - Intergenic
963521627 3:146364313-146364335 GGCACTTGTAGCAAACTCCTGGG - Intergenic
963663347 3:148153911-148153933 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
963684334 3:148416608-148416630 GGCACATGTAGCAAGCTCCTGGG - Intergenic
964067877 3:152599600-152599622 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
964067900 3:152599703-152599725 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
964125450 3:153230143-153230165 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
964300250 3:155278632-155278654 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
964844153 3:161027697-161027719 TACACTTGTAACAAGTTCCTAGG - Intronic
964906510 3:161725311-161725333 GGCACTTGTAGCAAGCTTCTAGG + Intergenic
964940955 3:162157589-162157611 AGCACTTGTAGCAAGCTCCTGGG + Intergenic
964983638 3:162714662-162714684 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
964984868 3:162725973-162725995 GGCACTTGTAGCAAGCTACTGGG + Intergenic
965070332 3:163909803-163909825 GACACTTGTAGCAAGCTCCTGGG - Intergenic
965105226 3:164345569-164345591 AGCACTTGTAGCAAGCTCCTGGG + Intergenic
965262649 3:166504235-166504257 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
965286729 3:166827553-166827575 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
965336331 3:167433475-167433497 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
965624879 3:170675972-170675994 GGCACTTATAGCAAGCTCCTGGG + Intronic
965626307 3:170686774-170686796 AGCACTTGTAGCAAGCTCCTGGG + Intronic
965640037 3:170821408-170821430 GGCACTTATAGCAAGCTCCTGGG + Intronic
965713411 3:171578674-171578696 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
965861967 3:173159358-173159380 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
966085434 3:176063595-176063617 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
966105082 3:176325073-176325095 GGCACTTGCAGCAAGCTCCTGGG + Intergenic
966232845 3:177669289-177669311 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
966279306 3:178209792-178209814 GGCACTTGTAGGAAGCTCCTGGG - Intergenic
966397656 3:179519122-179519144 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
966854134 3:184182652-184182674 GGCACCTCCTGCAAGCTCCTGGG + Intronic
967005359 3:185377982-185378004 GGCACTTGTAGCAAGCTCCTGGG + Intronic
967244164 3:187469721-187469743 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
967496224 3:190146765-190146787 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
967624648 3:191669938-191669960 AGCACGTGTAGCAAGCTCTGTGG + Intergenic
967643827 3:191898819-191898841 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
967658104 3:192074535-192074557 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
967740488 3:192997943-192997965 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
968993386 4:3929638-3929660 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
969003809 4:4003666-4003688 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
969654097 4:8486232-8486254 GGCACTTGTAGCAAGCTCCTGGG + Intronic
969749058 4:9096519-9096541 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
969810118 4:9641159-9641181 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
970029231 4:11657183-11657205 GGCACATGTAGCAAGCTCCTGGG + Intergenic
970042093 4:11808533-11808555 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
970087550 4:12366022-12366044 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
970256419 4:14173980-14174002 GGTACTTGTAGCAAGCTCCTGGG + Intergenic
970532738 4:16999922-16999944 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
971180566 4:24325470-24325492 GACACTTGTAGCAAGCTCCTGGG - Intergenic
971484964 4:27149721-27149743 TGCATTTCTAACAAGCTCCTGGG - Intergenic
971552652 4:27976224-27976246 AGCACTTGAAGCAAGATCCTGGG - Intergenic
972070811 4:35018207-35018229 CACACTTGAAGCAAGATCCTAGG + Intergenic
973108559 4:46371990-46372012 TGCATTTCTAACAAGCTCCTGGG - Intronic
973581043 4:52344454-52344476 GGCAATTGTAGCATGATCCAAGG - Intergenic
973751127 4:54022063-54022085 GGCACTTGAAGCAAGCTCCTGGG - Intronic
974345349 4:60673243-60673265 TGCACTTTTAGCAAGCACCCAGG + Intergenic
974428396 4:61767742-61767764 GGCATGTGTAGCAAGTTCCTGGG + Intronic
974823211 4:67094661-67094683 TGCATTTCTAACAAGCTCCTAGG + Intergenic
975509458 4:75177726-75177748 GCCTCTTTAAGCAAGCTCCTGGG + Intergenic
975623791 4:76321846-76321868 GGCATTTGTAGCAACCTGCATGG + Intronic
976558573 4:86476847-86476869 GGCACTTGTAGCAAGCTCCTGGG - Intronic
976739955 4:88347201-88347223 GGCACTTGAAGCAAGATCCTGGG + Intergenic
976830575 4:89309188-89309210 GGCATTTCTAACAAGCTCCCAGG + Intergenic
976884569 4:89968246-89968268 GGAACTTGTAGCAAGCTCCTCGG + Intergenic
977010318 4:91626347-91626369 GGCACTTGTGGCAAGCTCCTGGG - Intergenic
977012922 4:91658076-91658098 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
977062506 4:92274944-92274966 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
977075203 4:92442415-92442437 GGCAAGTGTAGCAAGCTCCTTGG + Intronic
977217152 4:94296669-94296691 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
977782436 4:100995233-100995255 CGCACTTGAAGCAAGTTCCCGGG + Intergenic
978001117 4:103557217-103557239 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
978031486 4:103943398-103943420 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
978303227 4:107293874-107293896 AGCACTTGAAGCAAGATCCTGGG + Intergenic
978438613 4:108711284-108711306 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
978503006 4:109428989-109429011 TGCATTTCTAGCAAGCTCCCAGG - Intergenic
978837512 4:113170602-113170624 AAAACTTGTAGCAAGCTCATGGG + Intronic
979054620 4:115979107-115979129 GGCAATTATAGGAAGCTCCTGGG + Intergenic
979146621 4:117254357-117254379 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
979895156 4:126148590-126148612 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
980003350 4:127514900-127514922 GGCACTTGTAACAAGCTCCTGGG + Intergenic
980111924 4:128644308-128644330 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
980284949 4:130769617-130769639 GGCACTTGTAGCAAGTTTCTGGG - Intergenic
980388927 4:132120457-132120479 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
980472439 4:133267146-133267168 GGCATGTGTAGCAAGCTCCTGGG + Intergenic
980527871 4:134014431-134014453 GGCACTTGTAGCAAGTTCCTGGG - Intergenic
980575634 4:134681360-134681382 GGCACTTGTAGCAAGCTACTGGG + Intergenic
980611774 4:135170744-135170766 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
980903940 4:138930128-138930150 GGCACTTGTAGCAAGCTACTGGG - Intergenic
981040246 4:140215751-140215773 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
981482725 4:145254999-145255021 GGAACTTGAAGCAAGATCCTGGG + Intergenic
981525212 4:145701357-145701379 GGCACTTGTAGCAAGCTCCTGGG - Intronic
982083965 4:151816056-151816078 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
982396716 4:154922292-154922314 AGCACTTGTAGCAAGCTCCTGGG + Intergenic
982414194 4:155111915-155111937 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
982745073 4:159098197-159098219 GGCACATGGAACAAGCTCCCAGG + Intergenic
983023873 4:162711358-162711380 GGCACTTGTGGCAAGCTCCTGGG - Intergenic
983055490 4:163095345-163095367 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
983345558 4:166522779-166522801 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
983448062 4:167878527-167878549 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
983452337 4:167925151-167925173 GGCACTTGTAACAAGCTCCTGGG - Intergenic
983659574 4:170118711-170118733 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
983707676 4:170679749-170679771 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
983805788 4:171989484-171989506 GGCACTTGTAGCAAACTCCTGGG + Intronic
984099045 4:175464888-175464910 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
984165354 4:176298302-176298324 AGCACTTGTAGCAAGCTCCTGGG + Intergenic
984322190 4:178209379-178209401 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
984354788 4:178643990-178644012 TGCACTTCTAACAAGCTTCTGGG - Intergenic
984393612 4:179168343-179168365 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
984411729 4:179405475-179405497 GGCACTGGAAGCAAGATCCTGGG - Intergenic
984437265 4:179722703-179722725 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
985057394 4:186047651-186047673 GGCACTTGTAGCAAGCTCTTGGG + Intergenic
985389868 4:189482917-189482939 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
985582357 5:705046-705068 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
985999248 5:3617300-3617322 GGCACAGGTAGGAAGCTCCGTGG + Intergenic
986502641 5:8416353-8416375 AGCACTTGAAGCAAGATCCTGGG - Intergenic
986555040 5:9001999-9002021 GGCACTTGCAGCAAGCTCCTGGG + Intergenic
986621638 5:9681799-9681821 GGCATTTCTAACAAGCTCCCTGG - Intronic
986905776 5:12492058-12492080 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
987282042 5:16422271-16422293 GACACTTGTAGCAAGCTTCTGGG - Intergenic
987486838 5:18535932-18535954 GGCATGTGTAGCAAGCTCCTGGG - Intergenic
988199099 5:28047896-28047918 GTCACTTGGAGCAAGATCCTGGG - Intergenic
989659927 5:43788372-43788394 AGCACTTGAAGCAAGATTCTGGG - Intergenic
989688899 5:44118188-44118210 AGCACTTGAAGCAAGATCCTGGG + Intergenic
992008280 5:72500842-72500864 TGCATTTCTAACAAGCTCCTAGG + Intronic
992394664 5:76359611-76359633 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
992452001 5:76883837-76883859 AGCACTTGTAGCAAGCTCCTGGG + Intronic
992960832 5:81955515-81955537 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
993836709 5:92826232-92826254 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
993880323 5:93353288-93353310 GGCCCTTGTACCAAGCTCTGAGG + Intergenic
993984270 5:94578819-94578841 TGCATTTGTAGCAAGTTCCTGGG + Intronic
994295150 5:98081322-98081344 GTCACTTGTAGCAAGCTCCTGGG - Intergenic
994324877 5:98436825-98436847 GGCACTTGAGGCAAGTACCTGGG - Intergenic
994375784 5:99014761-99014783 GGCACTTGAAGGGAACTCCTGGG + Intergenic
994532543 5:100987707-100987729 AGCATGTGTAGCAAGCTCCTGGG + Intergenic
994556940 5:101317193-101317215 GGCACTTGTAGCAAGCTCCTCGG - Intergenic
994775686 5:104033874-104033896 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
994778946 5:104067641-104067663 GGCATGTGTAGCAAGCTCCTGGG + Intergenic
994989555 5:106980637-106980659 GGCACTTGTAGCAAGCTCATGGG - Intergenic
995125159 5:108571910-108571932 GGCACTTGTAGCAAGCTCTTGGG + Intergenic
995296678 5:110532098-110532120 GGCACTTGTAGCAAGCTCCTGGG - Intronic
995769385 5:115652788-115652810 AGCACTTGAAACAATCTCCTGGG - Intergenic
995916210 5:117248089-117248111 TGCATTTTTAGCAAGCTCCCAGG + Intergenic
995949633 5:117694779-117694801 TGCAGTTGTAGCAAGCTCCCAGG + Intergenic
996052673 5:118950661-118950683 AGCACTTGAAGCAAGATCCTGGG + Intronic
996358621 5:122622321-122622343 AGCACTTGTAGCAAGCTCCTGGG + Intergenic
996509901 5:124306050-124306072 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
996528056 5:124499311-124499333 AGCACTTGTAGCAAGCTCCTGGG - Intergenic
996610092 5:125368348-125368370 TGCATTTCTAGCAAGCTCCCAGG + Intergenic
996878051 5:128261804-128261826 TGCACTCGTAGCATGCTTCTGGG + Exonic
996912444 5:128670674-128670696 GGCCCTTGTAGCAGGCTCCTGGG + Intronic
996917683 5:128731803-128731825 GGCACTTGAAGCAAGATCCTGGG - Intronic
997678860 5:135735128-135735150 AGCACTTGAAGCAAGTTCCTTGG + Intergenic
997746403 5:136303570-136303592 GGCACTTGTAGCAAGCTCCTGGG - Intronic
997772642 5:136568801-136568823 GGCACATGTAAAAAGCTCCTGGG + Intergenic
998693701 5:144614791-144614813 GGCACATGTAGCAAGCTCTTGGG + Intergenic
998996396 5:147872426-147872448 GGCACTTGTAGGAAGCTCCTGGG + Intronic
999618868 5:153453163-153453185 GGCACGTGTAGCAAGCTTCTGGG + Intergenic
1000438588 5:161242224-161242246 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1000439723 5:161250749-161250771 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1000470796 5:161638878-161638900 GGCATTTGTTGCACCCTCCTTGG - Intronic
1000519403 5:162278830-162278852 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1000606932 5:163336281-163336303 CGCACTTGAGGCAAGATCCTGGG - Intergenic
1000642807 5:163723501-163723523 GGCATTTCTAACAAGATCCTTGG - Intergenic
1000669146 5:164039110-164039132 TGCACTTCCAGAAAGCTCCTAGG - Intergenic
1000885319 5:166742544-166742566 GGCATGTGTAGCAAGCTCCTGGG + Intergenic
1000935640 5:167301341-167301363 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1001156163 5:169274087-169274109 GGCACTTCTAGCAAGTTCCCAGG - Intronic
1001218170 5:169875222-169875244 CGCAGTTGCAGCAAGCTCCCTGG - Intronic
1001331447 5:170765487-170765509 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1001435158 5:171694302-171694324 GTCACTTGTTGGAAGCTTCTTGG + Intergenic
1002610958 5:180418179-180418201 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1003046178 6:2734916-2734938 TGCATTTGTAGCCAGCTCCCAGG + Intronic
1003430164 6:6031236-6031258 GGCACTTGTAGTAAGCTCCTGGG + Intergenic
1004020109 6:11769475-11769497 TGCATTTCTAACAAGCTCCTGGG - Intronic
1004283521 6:14300405-14300427 GGGATATGTAGCAAGCTCCTCGG + Intergenic
1004290909 6:14366404-14366426 TGCATTTCTAGCAAGCTCCATGG - Intergenic
1004360638 6:14967801-14967823 TGCACTTCTAACAAGCTCCCAGG + Intergenic
1004495248 6:16156829-16156851 GGCCCTTGTAGCTGGCACCTAGG - Intergenic
1004507994 6:16262446-16262468 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1004768572 6:18757519-18757541 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1004837004 6:19541161-19541183 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1005251985 6:23957179-23957201 TGCATTTCTAACAAGCTCCTAGG + Intergenic
1005786572 6:29250660-29250682 GGCACTTGAAGCAAGATCCTGGG + Intergenic
1006376098 6:33672407-33672429 TGCACTTCTAACAAGCTCCCAGG - Intronic
1008084393 6:47229022-47229044 TGCATTTCTAACAAGCTCCTGGG - Intergenic
1008476528 6:51940440-51940462 AGCACTTGTAGTAAGCTCCTGGG - Intronic
1008850211 6:56014268-56014290 AGCACTTGTAGCAAGCTCCTTGG + Intergenic
1009269823 6:61602359-61602381 GGCACTCGTAGCAAGATCCTGGG - Intergenic
1009379147 6:63007571-63007593 AGCACTTGTAGCAAGCTCCTGGG - Intergenic
1009942913 6:70309737-70309759 TGCATTTCTAGCAAGCTCCCAGG + Intergenic
1010071722 6:71752001-71752023 GGCACTTGTAGCAAGTTCCTGGG + Intergenic
1010189854 6:73183917-73183939 AGCACTGATAGCAATCTCCTAGG + Intronic
1010826910 6:80485891-80485913 GGCACTTGTAGCAAACTCCTGGG + Intergenic
1010829688 6:80513759-80513781 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1010841312 6:80651251-80651273 GGCACTTCTAGCAAGCTCCTGGG + Intergenic
1010894543 6:81348591-81348613 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1010902705 6:81447402-81447424 GACACTGGTAGCAAGGCCCTAGG + Intergenic
1011750083 6:90446829-90446851 TGCATTTTTAACAAGCTCCTGGG + Intergenic
1011770942 6:90673666-90673688 GGCAAGTGTAGCAAGCTCCTGGG + Intergenic
1012675101 6:102104213-102104235 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1013407886 6:109859209-109859231 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1013808083 6:114015766-114015788 AGCACTTGAAGCAAGAACCTGGG + Intergenic
1013843679 6:114425777-114425799 GGCATGTGTAGCAAGCTCCTGGG + Intergenic
1013891705 6:115034137-115034159 GGCATGTGTAGCAAGCTCCTGGG - Intergenic
1014052228 6:116968241-116968263 GATATTTCTAGCAAGCTCCTAGG + Intergenic
1014092124 6:117415832-117415854 TGCACTTGTAACAAGCTCCCAGG - Intronic
1014360158 6:120465720-120465742 AGCATGTGTAGCAAGCTCCTGGG + Intergenic
1014612086 6:123558898-123558920 GGCACTTGTGGCAAGGTCCTGGG - Intronic
1014614671 6:123585742-123585764 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1014774758 6:125495452-125495474 GGCATTTCTAGCAAGTTCCCAGG + Intergenic
1014793989 6:125705315-125705337 GGCACATGTAGCAAGCTCCTGGG + Intergenic
1014891546 6:126851010-126851032 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1015165222 6:130194600-130194622 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1015266737 6:131297712-131297734 GGCACATGTAGCAAGCTCCTGGG - Intergenic
1015269659 6:131325659-131325681 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1015271375 6:131341137-131341159 GGCACTTGTAGTAAGCTCCTGGG - Intergenic
1015278155 6:131405069-131405091 GGCACATGTAGCAAGCTCCTGGG - Intergenic
1015801375 6:137064779-137064801 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1016114139 6:140260864-140260886 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1016204538 6:141455086-141455108 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1016518808 6:144925428-144925450 GGCATGTGTAGCAAGCCCCTGGG - Intergenic
1016535757 6:145106603-145106625 GACACTTGTAGCAAGCTCCTGGG + Intergenic
1016650289 6:146453869-146453891 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1016853271 6:148642056-148642078 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1017269816 6:152492470-152492492 AGCACTTGAAGCAAGATCCTGGG - Intronic
1017389500 6:153923741-153923763 GGCACGGGTAGCAAGCTCCTGGG - Intergenic
1017391728 6:153947111-153947133 TGCACTTCTAACAAGCTCCTAGG + Intergenic
1017779329 6:157704101-157704123 AGCACTTGTAGCAACCTCCTGGG + Intronic
1018077599 6:160230751-160230773 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1018084494 6:160290025-160290047 GGCACCTGTAGCAAGCTCCTGGG + Intergenic
1019610401 7:1933866-1933888 GCCACTTGCAGCCAGTTCCTGGG + Intronic
1019916721 7:4138096-4138118 GGCACTGGAAGAAAACTCCTTGG - Intronic
1019961788 7:4466630-4466652 TGCATTTCTAACAAGCTCCTGGG - Intergenic
1020316052 7:6906046-6906068 GACACTTGTAGCAAGCTCTTGGG - Intergenic
1020323943 7:6960121-6960143 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1020532712 7:9356873-9356895 GGCATGTGTAGCAAGCTCCTGGG + Intergenic
1020541139 7:9462009-9462031 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1020794216 7:12661823-12661845 GGCACTTGAAGCAAGCTCCTGGG - Intergenic
1021263543 7:18490291-18490313 TGCACTTCTAGCAAGTTCCCAGG + Intronic
1021393625 7:20122859-20122881 GGCACTTGTAGCAAGCTTCTGGG - Intergenic
1021429851 7:20547705-20547727 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1021637319 7:22705500-22705522 AGCACTTGTAGCAAGCTCCTGGG - Intergenic
1021660627 7:22915375-22915397 AGCACTTGAAGCAAGATCCTGGG - Intergenic
1021810665 7:24398533-24398555 AGCACTTGTAGCAAGCTCCTGGG - Intergenic
1021977893 7:26027641-26027663 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1022372875 7:29787103-29787125 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1022572790 7:31470481-31470503 TGCACTTGTAGCAAGCTCCTGGG + Intergenic
1022710044 7:32841357-32841379 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1022854707 7:34303346-34303368 GGCACTTGTAGCAAGTTCCTGGG + Intergenic
1023278961 7:38550241-38550263 TGCATTTCTAGCAAGCTCCCTGG - Intronic
1023698884 7:42874061-42874083 GGCACTTGTAACAAGTTCCTGGG + Intergenic
1023727924 7:43163562-43163584 GTGACTTGTAGCAAGCTCCCTGG - Intronic
1024739251 7:52337099-52337121 AGCACTTGAAGCAAGATCCTGGG + Intergenic
1024881074 7:54086026-54086048 GGCACTACTATCCAGCTCCTTGG + Intergenic
1026319778 7:69258455-69258477 GGCATTTCTACCAAGCTTCTAGG - Intergenic
1026496141 7:70905108-70905130 TGCATTTCTAACAAGCTCCTAGG - Intergenic
1027157888 7:75781409-75781431 GGCACTTGAATCAAGATCCTGGG - Intronic
1027158318 7:75784185-75784207 AGCACTTATAGCAAGCTCCTGGG - Intronic
1027721435 7:81746956-81746978 GGCACTAATAACAAGCTCCCAGG + Intronic
1027851947 7:83461921-83461943 GGCACATGTAGCAAGCTCCTGGG - Intronic
1028589908 7:92483242-92483264 GGCACTTGAAGCAAGATCCTGGG + Intergenic
1028670512 7:93396187-93396209 GGCACTTGCAGCAAGCTCCTGGG - Intergenic
1028690180 7:93642117-93642139 GGCACTTGCAGCAAGCTCCTGGG - Intronic
1029500216 7:100924426-100924448 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1030163608 7:106531855-106531877 AGCACTTGTAGCAAGCTCCTGGG + Intergenic
1030441685 7:109595480-109595502 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1030445781 7:109645572-109645594 GGCACTTGAAGCAAGATCCTGGG + Intergenic
1030751496 7:113237032-113237054 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1031004670 7:116457740-116457762 GGCACGTGTAGCAAGCTCCTGGG - Intronic
1031355193 7:120780598-120780620 CACACTTGTAGCAAGCTCCTGGG + Intergenic
1031364744 7:120889066-120889088 AGCACCTGTAGCAAGCTCCTGGG + Intergenic
1031399987 7:121317828-121317850 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1031422453 7:121567433-121567455 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1031685848 7:124731295-124731317 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1031727930 7:125262356-125262378 GGCACTTATAGCAAGCTCCTGGG + Intergenic
1031777346 7:125919870-125919892 GGCACTTGTAGCAAGCTCTTGGG - Intergenic
1032220389 7:129989990-129990012 GGCACTGGTCTCAAACTCCTGGG - Intergenic
1033084719 7:138331285-138331307 GGCACTTGAAGCAAGATCCTGGG - Intergenic
1033088559 7:138364807-138364829 GGCACTTGAAGCAAGATCCTGGG - Intergenic
1033422001 7:141211879-141211901 TGCACTTGTAGCAAGTTCCTAGG + Intronic
1033465032 7:141582239-141582261 GGCACTTGAAGCAAGTTCCTGGG + Intronic
1033625589 7:143107078-143107100 GGCACTTGAAGCAAGATCCTGGG - Intergenic
1033675949 7:143540676-143540698 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1033695886 7:143788763-143788785 AGCACTTGTAGCAAGCTCCTGGG - Intergenic
1033909466 7:146246833-146246855 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1034084831 7:148313504-148313526 AGCACTTGTAGCAAGCTCCCGGG + Intronic
1035054193 7:156023031-156023053 TGCACTTCTAGGAAGCTCCTGGG - Intergenic
1035880662 8:3241670-3241692 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1036070921 8:5440095-5440117 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1036281484 8:7404694-7404716 TGCATATGTAGCAAGCTCCTGGG - Intergenic
1036339985 8:7906878-7906900 TGCATATGTAGCTAGCTCCTGGG + Intergenic
1036372133 8:8170863-8170885 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1036472328 8:9062889-9062911 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1036639495 8:10573525-10573547 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1036878768 8:12494778-12494800 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1039499001 8:38002131-38002153 AGCACTTGAAGCAAGATCCTGGG + Intergenic
1040017317 8:42710191-42710213 TGCACTTATAGTCAGCTCCTTGG + Intronic
1041226202 8:55701166-55701188 GGCACCTGTAGTCAGCTACTCGG + Intronic
1041432950 8:57804939-57804961 GGCACTTGTATCCTTCTCCTTGG - Intergenic
1041917532 8:63151751-63151773 TGCACTTGAAGCAAGATCCTGGG + Intergenic
1042173697 8:66018134-66018156 GACACTTTTAGCAGGTTCCTAGG - Intergenic
1042453559 8:68975428-68975450 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1042477933 8:69270271-69270293 TGCATTTCTAACAAGCTCCTGGG + Intergenic
1042706084 8:71666661-71666683 AGCACTTGAAGCAAGATCTTGGG - Intergenic
1042707371 8:71677168-71677190 GGCGCGTGTAGCAAGCTCCTGGG - Intergenic
1043353669 8:79389559-79389581 AGCACGTGTAGCAAGCTCCTGGG + Intergenic
1043435110 8:80230335-80230357 TGCATTTCTAACAAGCTCCTGGG + Intronic
1043597453 8:81901991-81902013 GGCACTTGAAGCAAGATCCTGGG + Intergenic
1043717895 8:83508595-83508617 GGTAGTTGTGGCAAGCTCCTGGG + Intergenic
1043720908 8:83546226-83546248 GGCACTTGAAGCAAGATCCTGGG - Intergenic
1043837739 8:85065229-85065251 AGCACTTATAGCAAGCTCCTGGG - Intergenic
1044148515 8:88745669-88745691 GGCACGTGTAGCAAGCTCTTGGG + Intergenic
1044258613 8:90093658-90093680 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1044417086 8:91950224-91950246 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1044921993 8:97177331-97177353 GGCACATGTAGCAAGCTCCTGGG - Intergenic
1044925160 8:97203175-97203197 GGCATGTGTAGCAAGCTCCTGGG - Intergenic
1044943784 8:97370867-97370889 GGCATTTGTAGCAACCTGGTTGG + Intergenic
1045197523 8:99946126-99946148 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1045682182 8:104674074-104674096 GGTTCTTGTAGCAGGCTGCTGGG + Intronic
1046074910 8:109303067-109303089 AGCACTTGAAGCAAGATCCTTGG - Intronic
1046294121 8:112198079-112198101 GGCACTCGTAGCAAGCTCCTGGG - Intergenic
1046440014 8:114243593-114243615 GGCACGTGTCGCAAGCTCCTGGG - Intergenic
1047699348 8:127433984-127434006 GGCACATGTAGCAAGCTCCTGGG - Intergenic
1047829542 8:128615362-128615384 GGTACTTGTAGCAAGCTTCTAGG + Intergenic
1047856375 8:128916675-128916697 GGCATTTGTGGCAAGCTCCTGGG - Intergenic
1048097612 8:131312461-131312483 GGCACTTGTAGCAAGCTCTGGGG - Intergenic
1048135473 8:131742977-131742999 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1048143774 8:131821441-131821463 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1048585418 8:135770595-135770617 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1048728418 8:137411729-137411751 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1048764234 8:137828270-137828292 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1049868816 8:144957713-144957735 GGCACCTGTAGCAAGCTCCTGGG + Intergenic
1050117604 9:2277823-2277845 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1050258105 9:3814605-3814627 GGCACTTGTAGCAAGCTTCTGGG + Intergenic
1050371906 9:4930829-4930851 GGCAGTTCTAACAAGCTCCCAGG - Intergenic
1050896076 9:10887023-10887045 GGCACTTACAGCAAGCTCCTGGG - Intergenic
1051095612 9:13462206-13462228 TGCATTTCTAACAAGCTCCTAGG - Intergenic
1051849283 9:21489155-21489177 GGCACTTGCAGCAAACTCCTGGG + Intergenic
1051869402 9:21719293-21719315 TGCATTTCTAGCAAGCTCCCAGG - Intergenic
1051953404 9:22662021-22662043 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1052163085 9:25289929-25289951 AGCACTTGTAGCAAGCTCCTGGG - Intergenic
1052322092 9:27178799-27178821 GATACTTGTAATAAGCTCCTGGG - Intronic
1052653336 9:31328671-31328693 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1052720639 9:32167965-32167987 GGCACTTGCAGCAAGCTCCTGGG + Intergenic
1053058034 9:35005745-35005767 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1053059919 9:35022761-35022783 AGCACTTGAAGCAAGATCCTGGG + Intergenic
1053371535 9:37565523-37565545 GCCACTTCTAACAAGCTCCTAGG - Intronic
1054807486 9:69408206-69408228 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1055233064 9:74087920-74087942 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1055347716 9:75355234-75355256 GGCACTTGTGGCAAGCTCCTGGG + Intergenic
1055626724 9:78183064-78183086 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1055810048 9:80139668-80139690 AGCACATGTAGCAAGCTCCTGGG - Intergenic
1055881749 9:81011264-81011286 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1056044735 9:82704165-82704187 GGCACTTGTAGCAAGCTCCTAGG + Intergenic
1056061161 9:82886014-82886036 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1056323887 9:85460903-85460925 GGCACGTGTCGCAAGCTCCTGGG - Intergenic
1057234848 9:93349862-93349884 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1057377995 9:94542084-94542106 GGCACTTGTAGCAAGCTCCTTGG - Intergenic
1057594119 9:96400265-96400287 GGCACTTCTCCCAAGCTACTTGG + Intronic
1057812579 9:98269264-98269286 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1058026205 9:100144147-100144169 GGCACTTGTAGCAAGCTTCTTGG + Intronic
1058612404 9:106790454-106790476 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1058679747 9:107430616-107430638 GGCATTTCTAACAAGCTCCCTGG + Intergenic
1059222132 9:112633609-112633631 GGCACATGAGGGAAGCTCCTAGG - Intronic
1059311767 9:113393296-113393318 GGCACTGGAAGCAGGCTACTTGG - Intronic
1059546156 9:115178073-115178095 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1059574623 9:115475616-115475638 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1060318466 9:122534087-122534109 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1060737881 9:126078081-126078103 GGCACTTGTAGCAAGCGCCTGGG + Intergenic
1061010978 9:127954564-127954586 GGCACTTGGAGCAGGCTCCAGGG - Intronic
1061107737 9:128544969-128544991 GGCACTTGTAAGAAGCTCTGTGG - Intergenic
1061583069 9:131549343-131549365 AACACTCGTAGCAAGCTCCTGGG - Intergenic
1061673515 9:132202480-132202502 GGCACGTGGAGCAGGCTCCGCGG - Intronic
1185827430 X:3265455-3265477 GGCACTTGTGGAAAGCTAATTGG + Intergenic
1185858427 X:3556577-3556599 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1185991063 X:4893849-4893871 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1186112862 X:6275631-6275653 GACACTTGTAGCAAGCTCCTGGG + Intergenic
1186504394 X:10079243-10079265 CGCACTTGGAACAAGCTCCCAGG - Intronic
1186683146 X:11896907-11896929 TGCATTTCTAGCAAGCTCCCAGG + Intergenic
1186784070 X:12942080-12942102 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1187086520 X:16048140-16048162 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1187099955 X:16182610-16182632 GGCACTTTTAGCAAGCTCCTGGG + Intergenic
1187103765 X:16220274-16220296 AGCACTTAAAGCAAGCTCCTGGG + Intergenic
1187554063 X:20334270-20334292 TGCACTTCTAACAAGCTCCTAGG + Intergenic
1188134602 X:26479888-26479910 TGCAATTCTAGCAAGCTCCCAGG - Intergenic
1188167184 X:26876069-26876091 TGCATTTCTAGCAAGCTCCCAGG - Intergenic
1188333017 X:28896043-28896065 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1188353717 X:29163333-29163355 TGCATTTCTAACAAGCTCCTAGG + Intronic
1188419489 X:29977535-29977557 GGCACTTGTAGCAAGCTCCTAGG - Intergenic
1188431028 X:30105601-30105623 GGCACTTGTAGCAAGCTCCTAGG - Intergenic
1188552654 X:31379762-31379784 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1188650112 X:32621849-32621871 TGCACTTCTAGCAAGTTTCTAGG - Intronic
1189148383 X:38678957-38678979 TGCATTTCTAACAAGCTCCTAGG + Intronic
1190398973 X:50012732-50012754 GGCATTTTGAACAAGCTCCTAGG - Intronic
1191014193 X:55791759-55791781 GGCGCTTGAAGCAAGATCCTGGG + Intergenic
1191805805 X:65133086-65133108 GGCACTTGAAGCAAGATCCTCGG + Intergenic
1191825555 X:65361975-65361997 GGCACTTGAAGCAAGATCCTAGG - Intergenic
1191893517 X:65969157-65969179 AGCACTTGTAACAAGAACCTGGG - Intergenic
1192706145 X:73529923-73529945 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1193537096 X:82729118-82729140 AGCACTTGAAGCAAAATCCTGGG - Intergenic
1193885931 X:86984063-86984085 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1194186246 X:90776770-90776792 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1194293623 X:92103688-92103710 GGCATGTGTAACAAGTTCCTGGG + Intronic
1194308538 X:92276511-92276533 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1194351292 X:92826749-92826771 GGCACGTGTAGCAAGCTCCTAGG - Intergenic
1194367109 X:93025191-93025213 GGCACTTGTAGCAAGCTCCTCGG - Intergenic
1194502979 X:94702271-94702293 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1194660691 X:96626284-96626306 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1194873797 X:99162889-99162911 AGCACTTATAGCAAGCTCCTGGG + Intergenic
1195016951 X:100789872-100789894 GGCACTTGAAGCAAGATCCTGGG + Intergenic
1195291153 X:103432981-103433003 GGCACTTGAAGCAAGTTCCTGGG + Intergenic
1195841488 X:109180679-109180701 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1195908675 X:109868667-109868689 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1196220983 X:113112170-113112192 GGCACTTGTGGCAAGCTCCTGGG + Intergenic
1196227215 X:113180252-113180274 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1196300014 X:114042241-114042263 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1196496867 X:116333081-116333103 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1196533538 X:116815916-116815938 AGCATGTGTAGCAAGTTCCTGGG + Intergenic
1196572501 X:117281417-117281439 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1196773851 X:119321217-119321239 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1196992683 X:121346441-121346463 GGCACTTGTGGCAAGCTCCTGGG + Intergenic
1197064919 X:122224293-122224315 GGCACTTATAGCAAGCTCCTCGG - Intergenic
1197352056 X:125392297-125392319 GGCATGTGTAGCAAGCTCCTGGG + Intergenic
1197470965 X:126865361-126865383 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1197499724 X:127228858-127228880 GGCACTTGTAGCAAGCTTCTGGG - Intergenic
1197933085 X:131714330-131714352 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1198598450 X:138261078-138261100 GGTACTTATAGCAAGTTCCTGGG - Intergenic
1198599397 X:138267761-138267783 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1198965926 X:142228808-142228830 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1199037991 X:143076383-143076405 TGCATTTGTAACAAGTTCCTGGG + Intergenic
1199576484 X:149317924-149317946 GACACTTGTAGCAAGTTCCTCGG - Intergenic
1200175989 X:154116703-154116725 GACACTTGTAACAAGCTGCCTGG + Intergenic
1200532836 Y:4358849-4358871 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1200611141 Y:5328234-5328256 GGCATGTGTAACAAGTTCCTGGG + Intronic
1200659617 Y:5943439-5943461 GGCACGTGTAGCAAGCTCCTAGG - Intergenic
1200914231 Y:8557274-8557296 TGCACTTGTGGGAAGCTCCGAGG + Intergenic
1201307503 Y:12563380-12563402 GGCACTTGAAGCAAGATCCTGGG + Intergenic
1201473503 Y:14357848-14357870 GGCACTTGAAGCAAGATCCTGGG + Intergenic
1201540633 Y:15101691-15101713 AGCACTTGAAGCAAGATCCTGGG + Intergenic
1201581393 Y:15514633-15514655 GGCATTTGTAGCAAGCTCCTGGG - Intergenic