ID: 1173763773

View in Genome Browser
Species Human (GRCh38)
Location 20:45587648-45587670
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1038
Summary {0: 303, 1: 184, 2: 210, 3: 143, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173763763_1173763773 19 Left 1173763763 20:45587606-45587628 CCTGGGCTACGGCATTCCTTGGC No data
Right 1173763773 20:45587648-45587670 CACTTGTAGCAAGCTCCTGGGGG 0: 303
1: 184
2: 210
3: 143
4: 198
1173763768_1173763773 -3 Left 1173763768 20:45587628-45587650 CCTGGTGGCCAGATTTCTGGCAC 0: 157
1: 314
2: 214
3: 192
4: 217
Right 1173763773 20:45587648-45587670 CACTTGTAGCAAGCTCCTGGGGG 0: 303
1: 184
2: 210
3: 143
4: 198
1173763766_1173763773 3 Left 1173763766 20:45587622-45587644 CCTTGGCCTGGTGGCCAGATTTC 0: 158
1: 207
2: 446
3: 128
4: 205
Right 1173763773 20:45587648-45587670 CACTTGTAGCAAGCTCCTGGGGG 0: 303
1: 184
2: 210
3: 143
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173763773 Original CRISPR CACTTGTAGCAAGCTCCTGG GGG Intergenic
900722537 1:4186686-4186708 CACTTGCAGCCAGCTCCTGGGGG + Intergenic
900840790 1:5047104-5047126 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
900847477 1:5115379-5115401 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
902050919 1:13563137-13563159 CACTTGAAGCAAGATCCTGGGGG - Intergenic
902970415 1:20044145-20044167 CCCTTGAAGCAAGATCCTGATGG + Intronic
903396023 1:23002401-23002423 CACTTGAAGCAAGATCCTGGGGG + Intergenic
904329218 1:29746923-29746945 CACTTGGAACCATCTCCTGGGGG + Intergenic
904393962 1:30205649-30205671 CACTTGAAGCAAAATCCTGGGGG - Intergenic
904418593 1:30377408-30377430 CACTTCCAGCAGGTTCCTGGAGG + Intergenic
904711637 1:32434604-32434626 CACGTGTACCAAGCTCTTGGGGG - Intergenic
904996478 1:34635411-34635433 CACGTGTAGCAAGCTCCTGGGGG + Intergenic
905060517 1:35135784-35135806 CACTTCTAGCAAGCTCCTGGGGG + Intergenic
905499783 1:38427338-38427360 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
906132597 1:43469422-43469444 CACTTGTCCCCAGCTCCTGCTGG + Intergenic
906744519 1:48212443-48212465 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
907108221 1:51903295-51903317 CACTAGTAGTGAGCTTCTGGAGG - Intergenic
907292636 1:53426553-53426575 CACTTGTAGCAAACTCCTGGGGG - Intergenic
907293606 1:53434503-53434525 CACTTGAAGCAAGATCCTGGGGG - Intergenic
907503564 1:54901314-54901336 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
907521262 1:55024857-55024879 CACTTGTAGCAAACTCCTGGGGG - Intergenic
908416817 1:63921327-63921349 CATTTCTAACAAGCTCATGGGGG + Intronic
908461712 1:64353421-64353443 CACGTGTAGCAAGCTCCTGTGGG + Intergenic
908591951 1:65645329-65645351 CACATGTAGCAAGCTCCTATGGG + Intergenic
908852407 1:68388522-68388544 CACATGTAGCAAGCTCCTGGGGG - Intergenic
909035477 1:70590561-70590583 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
909096151 1:71291169-71291191 CACATGGAGCAAGCTGTTGGTGG - Intergenic
909222657 1:72983286-72983308 CATGTGTAGCAGGATCCTGGAGG + Intergenic
909223649 1:72991237-72991259 CACATGTAGCAAGCTCCTGGGGG + Intergenic
909551016 1:76898227-76898249 CACTTGTAGCAAGCTCCTGGGGG + Intronic
909729433 1:78874544-78874566 CGCTTGAAGCAAGATCCTGATGG - Intergenic
909776689 1:79492016-79492038 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
909788265 1:79642178-79642200 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
909792974 1:79699797-79699819 CACTTGTAGCAAGCTCCTGTGGG + Intergenic
909909964 1:81247696-81247718 CATGTGTAGCAAGCTCCTGTGGG - Intergenic
909978447 1:82070969-82070991 CATGTGTAGCAAGCTCCTGTGGG + Intergenic
910049384 1:82957573-82957595 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
910144128 1:84058676-84058698 CACTTGTAGAGAGCTCCTGGGGG + Intergenic
910203594 1:84725126-84725148 CACTCCTAGCAATCTCCTGCTGG + Intergenic
911510612 1:98804694-98804716 CACTTGTAACAAGCTCCTTGGGG + Intergenic
911570404 1:99511894-99511916 CACTTGTAGCAAGCTCCTGTGGG - Intergenic
911759779 1:101601488-101601510 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
911966931 1:104382444-104382466 CACTTGAAGCAAGATCCTGGGGG - Intergenic
911983852 1:104598257-104598279 CACTTGAAGCAAGGGCCTGATGG - Intergenic
912296478 1:108475208-108475230 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
912327779 1:108785064-108785086 CACATGTTGCAAGCTGTTGGTGG + Intronic
912813568 1:112811696-112811718 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
912942942 1:114061114-114061136 CACTTGTCCCCAGCTCCTGCTGG - Intergenic
916328862 1:163593278-163593300 CACTTGAAGCAAGATCCTGGGGG - Intergenic
916941796 1:169685124-169685146 CACTTGAAGCAAGATCCTGATGG - Intronic
918347120 1:183615904-183615926 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
918567668 1:185951753-185951775 CACGTGTAGCAAGCTCCTGGGGG + Intronic
918714402 1:187768950-187768972 CACGTGTAGCAAGCTCCTGGGGG + Intergenic
918752427 1:188289728-188289750 CACATGGTGCAAGCTGCTGGTGG + Intergenic
919476402 1:198037050-198037072 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
920427339 1:205888725-205888747 CACTTAAAGCAAGATCCTGGGGG + Intergenic
920829404 1:209451192-209451214 CACATGTAGCAAGCTCCTGGGGG - Intergenic
920901527 1:210114266-210114288 CACTTAAAGCAAGATCCTGGGGG + Intronic
921212424 1:212911762-212911784 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
921268594 1:213446920-213446942 CAGTAGTAGTAGGCTCCTGGAGG + Intergenic
921459776 1:215413397-215413419 CACGTGTAGCAAGCTCCTGTGGG + Intergenic
921509262 1:216010263-216010285 CACTTGTAGCAAGCTCCTGGAGG - Intronic
921520133 1:216147804-216147826 CACGTGTAGCAAGCTCCTGGGGG - Intronic
921732970 1:218597246-218597268 CACGTGTAGCAAGCTCCTGGGGG + Intergenic
922048417 1:221968212-221968234 CACTTGTAGCAAACTCCTGGGGG - Intergenic
922049529 1:221976560-221976582 CATGTGTAGCAAGCTCCTGTGGG + Intergenic
922154065 1:223027860-223027882 CATGTGTAGCAAGCTCCTGGGGG + Intergenic
922363542 1:224843910-224843932 CACTTGAAGCAAGCTCCTGGGGG + Intergenic
922877086 1:228948492-228948514 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
922906400 1:229176676-229176698 CACTTGTAGCAAGCTCCTGTGGG - Intergenic
922934826 1:229414641-229414663 CACATGTAGCAAGCTCCTGTGGG - Intergenic
923075209 1:230603486-230603508 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
923214190 1:231833664-231833686 CACTTGTAGCAAGCTCCTGGGGG + Intronic
923244756 1:232120435-232120457 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
923257269 1:232232658-232232680 CACTTGTAGCAAGCTCCTGTGGG + Intergenic
923408619 1:233686889-233686911 CACTTGTAGCAAGCTCCTGTGGG + Intergenic
923770733 1:236935708-236935730 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
923962788 1:239103627-239103649 CACTTGTAGCAAGCCTCTGGGGG - Intergenic
924896177 1:248339684-248339706 CGCTTATAGCAAGCTCCTGGGGG + Intergenic
1063363171 10:5473368-5473390 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1063509594 10:6633049-6633071 CACATGTAGCAAGCTCCTGTGGG + Intergenic
1063527677 10:6800546-6800568 CACGTGTAGCAAGCTCCTGTGGG + Intergenic
1064663809 10:17630299-17630321 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1065437634 10:25718703-25718725 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1065443117 10:25772194-25772216 CATGTGTAGCAAGTTCCTGGGGG + Intergenic
1066103393 10:32137110-32137132 CACTTGAAGCAAGATCCTGGGGG + Intergenic
1066437211 10:35405934-35405956 CACTTGAAGCAAGATCCTGGGGG + Intronic
1067360408 10:45573469-45573491 CACCTGAAGCAAGTTCCTGGGGG - Intronic
1068058344 10:52037219-52037241 CACATGTAGCAAGCTCCTGTGGG + Intronic
1068179653 10:53502490-53502512 CATGTGTAGCAAGCTTCTGTGGG + Intergenic
1068230978 10:54169012-54169034 CATGTGTAGCAAGCTCCTGTGGG - Intronic
1068360777 10:55973457-55973479 CACTTGAAATAAGATCCTGGGGG - Intergenic
1068592339 10:58864472-58864494 CACGTGTAGCAAGCTCCTGTGGG + Intergenic
1069606956 10:69744844-69744866 CTCTTGAGGCAACCTCCTGGTGG + Intergenic
1070434091 10:76371646-76371668 CCCCTGTAGCAAGCTCTTGATGG - Intronic
1070474931 10:76820826-76820848 CATGTGTAGCAAGCTCCTGTGGG - Intergenic
1071187238 10:83059405-83059427 CACTTGAAGCAAGATCCTGTGGG - Intergenic
1071507064 10:86239019-86239041 CACATGTTGCAAGCTGTTGGTGG - Intronic
1071550786 10:86564692-86564714 CACTTGAAGCAATATCCTGGGGG + Intergenic
1071577906 10:86743275-86743297 CAATTGCAGAAAGCTCCTAGAGG - Intergenic
1071821742 10:89286952-89286974 CACTTGAAGCAAGATCCTGATGG - Intronic
1071897728 10:90084495-90084517 CACATGTAGCAAGCTCCTGTGGG + Intergenic
1071916205 10:90297262-90297284 CATGTGTAGCAAGTTCCTGGGGG - Intergenic
1072011273 10:91304942-91304964 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1072570477 10:96653972-96653994 CATTTCTAACAAGCTTCTGGGGG - Intronic
1072580264 10:96734469-96734491 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
1072809063 10:98445699-98445721 CACTCCTAGCAAGCTCCCTGGGG - Intronic
1072884529 10:99261847-99261869 CACTTGAAGCAAGATCCTGGGGG - Intergenic
1073014023 10:100384002-100384024 CACTTGAAGAAAGATCCTGGGGG - Intergenic
1073428833 10:103472929-103472951 CATTTTAAACAAGCTCCTGGAGG - Exonic
1073683530 10:105729621-105729643 CACTTGAAGCAAGATCCTGATGG - Intergenic
1073709486 10:106021074-106021096 CGCTTGTAGCAAGCTCCTGGGGG + Intergenic
1074019032 10:109564622-109564644 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1074740783 10:116482910-116482932 CACTTGCAGCAAGCTCCTGGGGG - Intergenic
1075248702 10:120847105-120847127 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1076582010 10:131518050-131518072 CACCTTTAGCAAGCGCATGGGGG + Intergenic
1077612188 11:3650192-3650214 CACTTGTAGCAAGCTCCTGGGGG - Intronic
1077679063 11:4222700-4222722 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1077688499 11:4319341-4319363 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1077766379 11:5163739-5163761 CACTTGTAGCAAGCTCCTGGGGG + Intronic
1077850792 11:6073292-6073314 CACATGTAGCAAGCTCCTGTGGG + Intergenic
1077883361 11:6368070-6368092 CACTTGTAGCGAGCTCCTGGGGG - Intergenic
1078046120 11:7915616-7915638 CACGTGTAGCAAGCTCCTGTGGG + Intergenic
1078185763 11:9050891-9050913 CAATTTTAGGAGGCTCCTGGTGG - Intronic
1079124704 11:17710083-17710105 CACATGTAGCAAGATCCAGAGGG - Intergenic
1079230517 11:18645286-18645308 CACTTGCAGCAAGCTCCTGGGGG - Intergenic
1079447467 11:20570045-20570067 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1079672567 11:23187394-23187416 CACGTGTAGCAAGCTCCTGGGGG + Intergenic
1079727069 11:23890637-23890659 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1079847686 11:25490674-25490696 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1080027912 11:27632539-27632561 CACTTGTGGCAAGCTCCTGGGGG + Intergenic
1080227361 11:29975665-29975687 CACTTGTAGCAAACTCGTGGGGG - Intergenic
1080994446 11:37582075-37582097 CACTTGAAGCAAGATCTTGGGGG + Intergenic
1081159709 11:39736662-39736684 CACTTGAAGCAAGATCCTGATGG - Intergenic
1081356810 11:42122832-42122854 CATGTGTAGCAAGCTCCTGTGGG - Intergenic
1081668704 11:44931516-44931538 CATTTGTAGAAAGCTGCTGAGGG - Exonic
1082197757 11:49324888-49324910 CACTTGAAGCAAGATCCTGAGGG + Intergenic
1083534414 11:63455166-63455188 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1084232307 11:67761940-67761962 CACTTGTGGCAAGCTCCTGGGGG - Intergenic
1084354197 11:68626399-68626421 CACTTGAAGCAAGATCGTGATGG - Intergenic
1084355557 11:68635968-68635990 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1084613270 11:70217732-70217754 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1084775844 11:71374527-71374549 CCCTTGCAGCAAGCTCCTAATGG - Intergenic
1085529072 11:77181128-77181150 CCCATGGAGCAGGCTCCTGGAGG + Intronic
1085570196 11:77552189-77552211 CACTTGGAGCAAGATCCTGGGGG - Intronic
1085627291 11:78083233-78083255 CACTTGAAGCAAGATCCTGAGGG - Intergenic
1085988019 11:81808471-81808493 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1086005023 11:82027477-82027499 CACTTGTAACAAGCTCCTGGGGG - Intergenic
1086125303 11:83343539-83343561 CACTTGTAGCAAGCTCTTGCAGG + Intergenic
1086133156 11:83421380-83421402 CACTTGAAGCAAGATCCTGATGG - Intergenic
1086134831 11:83435036-83435058 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1086136265 11:83446358-83446380 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1086550216 11:88045448-88045470 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1086658063 11:89383239-89383261 CACTTGAAGCAAGATCCTGAGGG - Intronic
1087099103 11:94347976-94347998 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1087099646 11:94351909-94351931 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1087196921 11:95311779-95311801 CACTTGTAGAGAGCTCCTGGGGG - Intergenic
1087314679 11:96590181-96590203 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
1087839537 11:102907534-102907556 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1087844735 11:102960360-102960382 AAGTTGAAGCAATCTCCTGGTGG + Intergenic
1088554965 11:111052449-111052471 TACTTGTAGCAAGCTCCTCGGGG - Intergenic
1089349098 11:117811538-117811560 CACTTGTAGTAAGCTCCTGGGGG - Intronic
1089471050 11:118720454-118720476 CACTTGTAGCAAGTTCCTGGGGG + Intergenic
1089867045 11:121641379-121641401 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1089953304 11:122549208-122549230 CACTTGAAGCAAGATCCTGATGG - Intergenic
1089987687 11:122829379-122829401 CACTTGTAGGAAGCTCCTGGGGG - Intergenic
1090107595 11:123869053-123869075 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1090526804 11:127546187-127546209 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1090546485 11:127772531-127772553 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1090850592 11:130567818-130567840 CACATGTAGCAAGCTCCTGGGGG + Intergenic
1090871952 11:130756965-130756987 CACTTGTAGCAAGCTCCTGGAGG + Intergenic
1091886521 12:4020787-4020809 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
1092416173 12:8291994-8292016 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1092592750 12:9966522-9966544 CACTTTTAGCAAGCTCCTGGGGG + Intronic
1092626743 12:10336384-10336406 CATGTGTAGCAAGCTCCTGGGGG + Intergenic
1092723715 12:11465625-11465647 CACATGTAGCAAGCTCCTGTGGG + Intronic
1092739319 12:11613150-11613172 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1092789713 12:12060649-12060671 CACTTGTAGCAAGCTCCTCGGGG - Intronic
1092924850 12:13263426-13263448 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1093024335 12:14232836-14232858 CACTTGAAGCAAGATCCTGGGGG - Intergenic
1093071160 12:14708329-14708351 CACATGTAGCAAGCTCCTGTGGG + Intergenic
1093268006 12:17025159-17025181 CATGTGTAGCAAGCTCCTGGGGG + Intergenic
1093321983 12:17723733-17723755 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1093578820 12:20765633-20765655 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1093584514 12:20820457-20820479 CACTTGTAGCAAGCTCCTGGGGG + Intronic
1093812832 12:23509467-23509489 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1093951074 12:25165404-25165426 CACTTGTAGCAAGCTCCTGGGGG - Intronic
1094316048 12:29138457-29138479 CATGTGTAGCAAGCTCCTGGGGG + Intergenic
1094400679 12:30058234-30058256 CAGTTGGGGCAAGCTCCTGGGGG - Intergenic
1094825758 12:34267894-34267916 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1095637657 12:44452053-44452075 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1095999022 12:48113587-48113609 CACTTGAAGCAAGATCCTGGGGG + Intronic
1096547432 12:52350298-52350320 CACTTATCGCAAACTGCTGGAGG + Intergenic
1096569933 12:52516650-52516672 CACTTACCGCAAGCTGCTGGAGG - Exonic
1096907189 12:54946383-54946405 CACTTGAAACAAGATACTGGGGG + Intergenic
1097398591 12:59104096-59104118 CACTTGTGGCAAGTTCCTGGGGG - Intergenic
1097417050 12:59326674-59326696 CACGTGTAGCAAGCTCCTGTTGG + Intergenic
1097542194 12:60955438-60955460 TGCTTGTAGCAAGCTCCTAGCGG + Intergenic
1097592428 12:61589508-61589530 CACTTGAAGCAAGATCCTGATGG - Intergenic
1097880008 12:64678365-64678387 CACTTGGAGAAAGCACCTGTTGG + Intronic
1098173634 12:67770103-67770125 CACGTGTAGCAAGCTCCTGTGGG + Intergenic
1098264726 12:68706789-68706811 CACTTAAAGGAAGCTGCTGGAGG + Intronic
1098402252 12:70087657-70087679 CACGCGTAGCAAGCTCCTGGGGG - Intergenic
1098629063 12:72705606-72705628 CACATGTAGCAAGCTCCTGTGGG - Intergenic
1098630028 12:72712349-72712371 CACTTGTAGCAAGCTCCTGTGGG + Intergenic
1098653824 12:73005419-73005441 CACTTGTAGCAGGCTCCTGGGGG + Intergenic
1098919909 12:76293716-76293738 CACTTGAAGCAAGCTCCTTGGGG - Intergenic
1099188718 12:79542116-79542138 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
1099292098 12:80786532-80786554 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1099299261 12:80870776-80870798 AACTTGGAGCTAGCACCTGGAGG - Intronic
1099360540 12:81694746-81694768 CACAGGTTGCAAGCTGCTGGTGG - Intronic
1099762590 12:86941056-86941078 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1099836095 12:87910846-87910868 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1100298358 12:93283923-93283945 CATTTGTAGAAAGGTCCTGATGG - Intergenic
1100561363 12:95751433-95751455 CATATGTAGCAAGCTCCTGTGGG - Intronic
1100940300 12:99717444-99717466 CACTTGTAGCAAGCTCCTGGGGG - Intronic
1101042922 12:100775244-100775266 CACTTCTAGCAACCTCCTTTGGG - Intronic
1101278395 12:103226135-103226157 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1101763787 12:107680837-107680859 CTCTTGAGGCAGGCTCCTGGTGG - Intergenic
1104257609 12:127154049-127154071 CACTTGAAGCAAGATCCTGATGG - Intergenic
1105032219 12:132891965-132891987 CACTTGAAGCAAGATCCTGATGG - Intronic
1106943447 13:34800900-34800922 CACTTGTAGCAAGCTTCTGTGGG - Intergenic
1107075582 13:36318699-36318721 CACGTGTAGCAAGCTCCTGTGGG - Intronic
1107220292 13:37972631-37972653 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1107683138 13:42870873-42870895 CACATGTAGCAAGCTCCTGTGGG + Intergenic
1108202699 13:48058654-48058676 CACTTATAGCAAGCTCCTGGGGG - Intronic
1108512999 13:51172124-51172146 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1108803868 13:54131146-54131168 CACTTGTAGCAAGCCCCTGGGGG + Intergenic
1108814130 13:54269113-54269135 CACGTATAGCAAGCTCCTGTGGG - Intergenic
1108913416 13:55581700-55581722 CACATGTAGCAAGCTCCTGTGGG + Intergenic
1108919542 13:55658429-55658451 CATGTGTAGCAAGCTCCTATGGG + Intergenic
1108952944 13:56115873-56115895 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1109343585 13:61090613-61090635 CACTTGTAGCAAGCTCCTGTGGG - Intergenic
1109352921 13:61207044-61207066 CACTTGTAGCAAGCTCCTGTGGG - Intergenic
1109499297 13:63215380-63215402 CACTTATAGCAAGCTCCTAGGGG - Intergenic
1109667080 13:65553455-65553477 GACTGGTAGAAAGCTCCAGGCGG - Intergenic
1109709663 13:66144792-66144814 CACGTGTAGCAAGCTCCTGTGGG + Intergenic
1109716739 13:66229836-66229858 CACGTGTAGCAAGCTCCTGTGGG + Intergenic
1110650480 13:77936775-77936797 CACTTGAAGCAAGATCCTGATGG + Intergenic
1110765479 13:79276392-79276414 CACTTGTAGGAAGCTCCTGGGGG - Intergenic
1110845345 13:80185929-80185951 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1110978494 13:81868431-81868453 CACTTGTAGCAAGCTTCTGGGGG - Intergenic
1111126041 13:83911736-83911758 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1111302051 13:86360663-86360685 CACATGTAGCAAGCTCCTGTGGG - Intergenic
1111362104 13:87189882-87189904 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1111458837 13:88516280-88516302 CACGTGTAGCAAGCTCCTGGGGG + Intergenic
1111630443 13:90841697-90841719 CATGTGTAGCAAGCTCCTGGGGG - Intergenic
1111631699 13:90852042-90852064 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1112236831 13:97644573-97644595 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1112889314 13:104211512-104211534 CACTTGTAGCAAGCTCTTGGGGG + Intergenic
1113324340 13:109267604-109267626 CACTTGCAGCAAGCTCCTGGGGG - Intergenic
1114221680 14:20702840-20702862 CACTTGAAGCAAGATCCTGGGGG - Intergenic
1115904811 14:38193048-38193070 CAAGTGTAGCAAGCTCCTGGGGG - Intergenic
1116179680 14:41518200-41518222 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
1116534775 14:46015859-46015881 CACTTGTAGAAAGCTCCTGGAGG + Intergenic
1116573458 14:46546184-46546206 CACTTGTAGCAAGCTCTTGGGGG - Intergenic
1116613517 14:47106438-47106460 CACATGTAGCAAGCTCCTGTGGG - Intronic
1116702402 14:48258837-48258859 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1116703286 14:48265829-48265851 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1116952916 14:50895428-50895450 CACGTGTAGCAAGCTCCTGTGGG - Intronic
1117174157 14:53130653-53130675 CACTTGAAGCAAGATCCTGGGGG - Intronic
1117801187 14:59446313-59446335 CACTTGTAGCAAGCTCCTGGGGG - Intronic
1117907554 14:60605972-60605994 CACATGGAGCAAGCTGTTGGTGG - Intergenic
1117908182 14:60611784-60611806 CACATGGAGCAAGCTGTTGGTGG + Intergenic
1117957908 14:61136877-61136899 CACTCGTAGCAAGCTCCTGCGGG + Intergenic
1118937250 14:70299257-70299279 CACTTGAAGCAAGATCCTGATGG + Intergenic
1119307496 14:73619455-73619477 CACTTGGAGCAATCCACTGGAGG + Exonic
1119317205 14:73705748-73705770 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
1120222077 14:81745836-81745858 CATTTCTAACAAGCTCCTGGTGG - Intergenic
1120251390 14:82064536-82064558 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1120438048 14:84503660-84503682 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1120539555 14:85736428-85736450 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1120618259 14:86733606-86733628 CACTTGTTGCAAGCTCTTGGGGG - Intergenic
1120659952 14:87238492-87238514 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1121289420 14:92762125-92762147 CACTTGAAGCAAGATCCTGAGGG - Intergenic
1121703654 14:95975205-95975227 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1121794986 14:96727375-96727397 CAGATGCAGCAAGTTCCTGGAGG + Intergenic
1121980579 14:98450579-98450601 CACTTGTAGCAAGCTCCTAGGGG + Intergenic
1122041000 14:98987456-98987478 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1122381320 14:101309126-101309148 CACTTGAAGCAAGATCCTGGGGG + Intergenic
1123882490 15:24689034-24689056 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1124654731 15:31499079-31499101 CACATGTGTCCAGCTCCTGGAGG - Intronic
1124824550 15:33080952-33080974 GCCTTGAAGCAAGCTCCGGGTGG - Intronic
1125045780 15:35241027-35241049 CACGTGTAGCAAGCTCCTGTGGG - Intronic
1125131513 15:36289096-36289118 CACGTGTAGCAAGCTCCTGGGGG + Intergenic
1125213214 15:37239650-37239672 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1125629224 15:41133765-41133787 CACTTGAAACAAGATCCTGGGGG - Intergenic
1125849094 15:42886783-42886805 CACTTGAAGCAAGATCCTGGGGG - Intronic
1126400686 15:48266551-48266573 CATTTCTAACAAGCTCCTGGAGG - Intronic
1126530151 15:49702591-49702613 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1126843751 15:52740844-52740866 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1126912402 15:53430287-53430309 CACTTGTAGGAAGCTCCTGGGGG + Intergenic
1129413724 15:75363281-75363303 CATTTTTAACAAGCTCCTGAAGG - Intronic
1130304556 15:82704509-82704531 CACTTGAAGCAAGATCCTGATGG - Intronic
1130724587 15:86425710-86425732 CACTTTTAGAAAGCTCCTTGGGG - Intronic
1130855118 15:87833524-87833546 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1130894652 15:88160584-88160606 CACTTCTAGCAGGGTCCAGGAGG + Intronic
1130945941 15:88550956-88550978 CACGTGTAGCAAGCTCCTGTGGG + Intergenic
1131164874 15:90135095-90135117 CACTTGAAGCAAGGTCCTGATGG - Intergenic
1131447752 15:92513768-92513790 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1131684184 15:94753031-94753053 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1131882513 15:96875279-96875301 CATGTGTAGCAAGCTCCTTGGGG + Intergenic
1132263018 15:100442544-100442566 CACTTGTAGCAAGCTCCTGGGGG - Intronic
1132340416 15:101074794-101074816 CACTTGTAGCAAGCTCCTGGGGG - Intronic
1132943394 16:2519534-2519556 CAGCTGGAGGAAGCTCCTGGGGG - Exonic
1133765733 16:8836468-8836490 CACGTGTAGCAAGCTCCTGGGGG + Intronic
1133766760 16:8843535-8843557 CACGTGTAGCAAGCTCCTGGGGG + Intronic
1133869540 16:9674568-9674590 CACTTGTAGCAATCTCCTGGGGG + Intronic
1133938179 16:10285412-10285434 CACTTGAAGCAAGCTCCTGGGGG - Intergenic
1134342175 16:13356023-13356045 CACGTGTAGCAAGCTCCTGTGGG + Intergenic
1134666494 16:16022546-16022568 CATTTCTAGCAAGCTTCCGGGGG - Intronic
1135025411 16:18995584-18995606 CACTTAGAGCAAGATCCTGGGGG + Intronic
1136108565 16:28049982-28050004 CACTGGAAGGAAGCTCCTTGAGG + Intronic
1136475538 16:30510906-30510928 CACTGGTAAACAGCTCCTGGGGG + Exonic
1136529954 16:30861414-30861436 CACTTGAAGCAAGATCCTGGGGG - Intronic
1137363433 16:47840782-47840804 CACTTGTGGCAAGCTCCTGGAGG - Intergenic
1138576122 16:57908362-57908384 CACTGGGAGCAAGGGCCTGGGGG + Intronic
1138804953 16:60081090-60081112 CACGTGTAGCAAGCTCCTAGGGG - Intergenic
1139039233 16:62982598-62982620 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1139225912 16:65233287-65233309 CACGTGTAGCAAGCTCCTGTGGG + Intergenic
1139943047 16:70619919-70619941 CACATGTAGCAAGCTCCTGTGGG + Intronic
1141355392 16:83340656-83340678 CATTTCTAACCAGCTCCTGGGGG + Intronic
1141865200 16:86745476-86745498 CACTTGTAGCAAGGTCCTTGGGG + Intergenic
1141924144 16:87156276-87156298 CACTTGAAGAGAGGTCCTGGAGG - Intronic
1143414342 17:6735057-6735079 CACTTGTAGCAAGCTCCTGAGGG + Intergenic
1143970196 17:10789815-10789837 CATTTCTAACAAGCTCCTAGGGG + Intergenic
1144104675 17:11974153-11974175 CACTTGTAGTAAGCTCCTGGGGG - Intergenic
1146597900 17:34185532-34185554 CACATGTAGCAAGCTCCTGGGGG - Intergenic
1149264142 17:54909296-54909318 CAACTGCAACAAGCTCCTGGGGG - Intronic
1149319571 17:55470057-55470079 CACTTGAAGCAAGATCCTGGGGG - Intergenic
1149483170 17:57019653-57019675 CACATGGTGCAAGCTCTTGGTGG + Intergenic
1150212169 17:63447199-63447221 CAGATGTAGCAAGCGCCTAGGGG + Intergenic
1151187938 17:72377811-72377833 CATTTCTAACCAGCTCCTGGGGG - Intergenic
1151622492 17:75254832-75254854 CACTTGTAGCAAGCTCCTGGGGG - Intronic
1151839752 17:76609406-76609428 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1151869246 17:76825439-76825461 CACTTGTAGAGAGCCCCTGGAGG - Intergenic
1152520410 17:80852835-80852857 CACCTGGGTCAAGCTCCTGGGGG - Intronic
1154497128 18:14970125-14970147 CATTTCTAACAAGCTCCTGGAGG + Intergenic
1155173822 18:23286298-23286320 CACTTGTAGCAAGCTCCTGGGGG - Intronic
1155697013 18:28696552-28696574 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1155941551 18:31806063-31806085 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1156237363 18:35218027-35218049 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1156251928 18:35359760-35359782 CACTCGTAGCAAGCTCCTGGGGG + Intergenic
1156302251 18:35846152-35846174 CACTTGTAGCGAGCTCCTGGGGG - Intergenic
1156924050 18:42555942-42555964 CACTTGTAGCAAGCTCCAGGGGG + Intergenic
1156938534 18:42738910-42738932 CACTTGTAGCAAGCTCCAGGGGG - Intergenic
1156958182 18:42993132-42993154 CACTTGTAGCAAGCTCCTGGGGG - Intronic
1157630611 18:49091659-49091681 CATTTCTAGCAAGTTCCTAGGGG + Intronic
1157906388 18:51573490-51573512 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1158336380 18:56417849-56417871 CACATGTAGCAAGCTCCTGTGGG - Intergenic
1158394641 18:57070078-57070100 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1158502221 18:58012912-58012934 CATTTCCAACAAGCTCCTGGTGG - Intergenic
1158576693 18:58644433-58644455 CACTTGAAGCAAGCTCCTGGGGG + Intergenic
1159164470 18:64683899-64683921 CTCTTGTAGCAAGTTCCTGGGGG - Intergenic
1159835055 18:73326895-73326917 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1161661721 19:5550729-5550751 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
1161711219 19:5849348-5849370 AACTTGTAGCAAGCTCCTGGGGG - Intronic
1163487293 19:17595687-17595709 CACTTGTAGCAAGCTCCTGGTGG - Intergenic
1163820494 19:19493823-19493845 CACTTGTCGAAAACTCATGGAGG + Intronic
1163900218 19:20094076-20094098 CACTTGAAGCAAGATCCTGATGG + Intronic
1163907187 19:20157791-20157813 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1163944448 19:20522532-20522554 CACTTGAAGCAAGATCCTGAGGG + Intergenic
1164004084 19:21133227-21133249 CACTTGAAGCAAGGTCCATGAGG + Intergenic
1164152975 19:22570499-22570521 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1164202501 19:23030272-23030294 CACTTGAAGTAAGATCCTGGGGG + Intergenic
1164459227 19:28433314-28433336 CACTTGTAGCAAGCTTCTGGGGG + Intergenic
1165497002 19:36158869-36158891 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1165510315 19:36262935-36262957 CACTTATAGCAAGCTCCTGGGGG + Intergenic
1165835361 19:38751869-38751891 CACTTGTAGCAAGCTCCTGGGGG - Intronic
1165941379 19:39416339-39416361 CCCCTGTAGCGAGCTCCTGGAGG + Exonic
1166498938 19:43326954-43326976 CACGTGTAGCAAGCGCCTGGGGG + Intergenic
1166905790 19:46107501-46107523 CACTTGAAGCAAGATCCTGGGGG + Intergenic
1166927138 19:46276777-46276799 CACTTGTAGCAAGTTCCTGGGGG + Intergenic
1167046600 19:47053199-47053221 CATGTGTAGCAAGTTCCTGGGGG + Intergenic
1167099462 19:47395305-47395327 CACTTGAAGCAAGATCCTGATGG - Intergenic
1167902152 19:52630030-52630052 CACTTGTAGCAAGCTCCTGGGGG - Intronic
1168051643 19:53833868-53833890 CATGTGTAGCAAGTTCCTGGGGG - Intergenic
1168212115 19:54898337-54898359 TACTTGTAGCAAGCTCCTGGGGG + Intergenic
1168227983 19:55010235-55010257 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1168248146 19:55124799-55124821 CACTTGAAGCAAGATCCTGATGG - Intergenic
925433854 2:3819355-3819377 CACTTGAAGCAAGATCCTGGTGG + Intronic
925544556 2:5003238-5003260 CATGTGTAGCAAGCTCCTGTGGG - Intergenic
925828816 2:7876113-7876135 CACGTGTAGCAAGCTCCTGTGGG + Intergenic
926407773 2:12572015-12572037 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
926413593 2:12628760-12628782 CATGTGTAGCAAGCTCCTGTGGG - Intergenic
926792205 2:16585309-16585331 CTCTTCTAGGAAGCTACTGGTGG + Intronic
926815544 2:16795393-16795415 CATATGTAGCAAGCTCCTGTGGG + Intergenic
927134164 2:20084574-20084596 CACTTGAAGCAAGATCTTGATGG - Intergenic
928770179 2:34696111-34696133 CACTTGTAGCAAGCTCTTGGGGG - Intergenic
928778307 2:34791966-34791988 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
928827653 2:35440549-35440571 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
928928566 2:36601294-36601316 CACTTGTAGTAAGCTCCTGGGGG - Intronic
929004830 2:37384422-37384444 CACTTGTAGCAAGCTCTTGTGGG + Intergenic
929076671 2:38084217-38084239 CACTTGTAGCAAGCTCCTAGGGG + Intronic
929383542 2:41380192-41380214 CACTTGAAGCAAGATCCTGAGGG - Intergenic
929684526 2:44022495-44022517 CACTGGAAGCAAGATCCTGGGGG + Intergenic
929793062 2:45037887-45037909 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
930099077 2:47589119-47589141 CACTTGAAGCAACATCCTGGGGG + Intergenic
930487361 2:52025565-52025587 CACTTGTAGCAAGCTCCTAGGGG + Intergenic
930955101 2:57195225-57195247 CATTTGTAGCAAGCTCCTGGGGG - Intergenic
930958383 2:57231147-57231169 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
931026390 2:58116867-58116889 CACTTGTAGCAAGCTCCTGGGGG + Intronic
931042617 2:58315955-58315977 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
931608923 2:64078621-64078643 CACTTGTGGCAAGCTCCTGGGGG + Intergenic
931625779 2:64254787-64254809 CACATGTAGCAAGCTCATGGGGG - Intergenic
931850427 2:66246190-66246212 CACTTGTAGCAAGCTCCTTGGGG - Intergenic
932159457 2:69447103-69447125 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
932295856 2:70622886-70622908 CACTTGTAGCAAGCTCCTGGGGG - Intronic
932321026 2:70822107-70822129 CACTTGTAGCTAGCATCTGAAGG + Intergenic
932358816 2:71088495-71088517 CACTTGCAGCAAACTCCTGGGGG + Intergenic
932367645 2:71163135-71163157 CATGTGTAGCAAGCTCCTGGGGG + Intergenic
932854208 2:75217244-75217266 CACATGTAGCAAGCTCCTGTGGG + Intergenic
932973953 2:76577305-76577327 CACGCGTAGCAAGCTTCTGTGGG + Intergenic
933013094 2:77090635-77090657 CACTTGTAGCAAGCTCCTGGGGG - Intronic
933079274 2:77967368-77967390 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
933137937 2:78760157-78760179 CACTTGAGGCAAGATCCTGGTGG - Intergenic
933329518 2:80877918-80877940 CACATGTAGCAAGCTCCTGGGGG + Intergenic
933552391 2:83792361-83792383 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
934141265 2:89050178-89050200 CACTTGAAGCAAGATCCCGGGGG - Intergenic
934227975 2:90150366-90150388 CACTTGAAGCAAGATCCCAGGGG + Intergenic
935518906 2:104079008-104079030 CACTTGTCCCCAGCTCCTGCTGG + Intergenic
936794291 2:116187720-116187742 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
936870795 2:117132578-117132600 CACTTGAAGCAAGATCCTGGGGG - Intergenic
936883337 2:117281000-117281022 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
937642676 2:124231051-124231073 CATTTGTAACAAGCTCCTGGTGG - Intronic
937665584 2:124483323-124483345 CACTGGTCCCAAGCTCCTAGTGG - Intronic
939083136 2:137686395-137686417 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
939243645 2:139594801-139594823 CACAGGGAGCAAGCTGCTGGTGG - Intergenic
939307415 2:140428398-140428420 CACTTGTAGCAAGCTCCTGGGGG - Intronic
939460731 2:142493284-142493306 CACTTGAAGCAAGTTCCTGGGGG + Intergenic
940107351 2:150114869-150114891 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
940182942 2:150955298-150955320 CACTTGAAGCAAGATCCTGGGGG - Intergenic
940396442 2:153196787-153196809 CACTTGTCCCTAGCTCCTGCCGG + Intergenic
940530191 2:154869580-154869602 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
940726436 2:157341554-157341576 CATTTGAAGCAAGATCCTGGGGG + Intergenic
941340402 2:164298114-164298136 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
941353388 2:164461369-164461391 CATATGTAGCAAGCTCCTGTGGG - Intergenic
941456186 2:165713947-165713969 TATGTGTAGCAAGTTCCTGGGGG + Intergenic
941935888 2:170981090-170981112 CACTTGTAGCAAGCTTCTGGGGG + Intergenic
942097088 2:172543997-172544019 CACTTGTAGCAAGCTTCTGGGGG - Intergenic
942730289 2:179055207-179055229 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
943061576 2:183046145-183046167 CACTTGAAGCAAGATCCTGATGG - Intergenic
943412929 2:187563930-187563952 CACTTGTAGCAAGCTCCTGGGGG + Intronic
943421582 2:187673929-187673951 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
943461190 2:188172656-188172678 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
943806653 2:192132682-192132704 CACTTGTAGCAAGCTCCTGGGGG - Intronic
943835405 2:192509739-192509761 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
943865347 2:192920318-192920340 CACTTGTAGCAAGCTTCTGGGGG - Intergenic
943951285 2:194134330-194134352 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
944251036 2:197580371-197580393 CACTTGAAGCAAGATCCTGGGGG - Intronic
944394142 2:199249184-199249206 CACGTGTAGCCAGCTCCTGGGGG - Intergenic
944401309 2:199329209-199329231 TACTTGTAGGAGGCACCTGGTGG - Intronic
944876129 2:203965368-203965390 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
945153101 2:206810309-206810331 CACATTTAGCAAGCTCCTGGGGG + Intergenic
945301482 2:208219688-208219710 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
945361651 2:208901499-208901521 CACTTGTAGGAAGCTCCTGGGGG - Intergenic
945376103 2:209080330-209080352 CACTTGTAGCAAGCTTCTGGGGG - Intergenic
945394303 2:209301482-209301504 CATGTGTAGCAAGTTCCTGGGGG - Intergenic
945521548 2:210833705-210833727 CACCTGCATCAAGCTCCTGTGGG + Intergenic
945554692 2:211263727-211263749 CACTTGAAGCAAGATCCCTGAGG - Intergenic
945858121 2:215091847-215091869 CACTTGAAGCAAGATCCTGGGGG - Intronic
945938320 2:215924630-215924652 CAAGTGTAGCAAGCTCCTGGGGG - Intergenic
945986607 2:216359508-216359530 CTCTTGAGGCAACCTCCTGGTGG - Intronic
946215028 2:218177483-218177505 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
946781042 2:223193292-223193314 CACTTGTAGCAAGCTCCTGGGGG + Intronic
946871754 2:224091302-224091324 CACTTGTAGCAAGCTCCCGGGGG + Intergenic
946893276 2:224298934-224298956 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
948390687 2:237609214-237609236 CACTTGTAGCAAGTTCCTGGGGG - Intergenic
948750337 2:240128564-240128586 CACATTTAGAAAGCTGCTGGGGG - Intronic
1168839268 20:898802-898824 CACTTGAAGCAAGATCCTGTGGG - Intronic
1168943277 20:1731194-1731216 CACTTAAAGCAAGATCCTGGGGG + Intergenic
1170068862 20:12343727-12343749 CATGTGTAGCAAGCTCCTGTGGG + Intergenic
1170106237 20:12756131-12756153 CATGTGTAGCAAGCTCCTGTGGG - Intergenic
1170165744 20:13359220-13359242 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1170325485 20:15151285-15151307 CACTTGTAGCAAGCTCCTGGGGG + Intronic
1170680431 20:18521049-18521071 CACTTGAAGCAAGCTCCTGCGGG + Intronic
1170784971 20:19459983-19460005 CATTTCTAACAAGCTCCTAGGGG + Intronic
1170820699 20:19754597-19754619 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1171944004 20:31359783-31359805 CTGTTTTAGCAAGCCCCTGGGGG + Intergenic
1172932467 20:38596168-38596190 CACTTGAAGCAAGATCCTGATGG + Intergenic
1173001867 20:39110663-39110685 CACTAGGTGGAAGCTCCTGGGGG - Intergenic
1173101914 20:40095607-40095629 CATGTGTAGCAAGCTCCTGGGGG - Intergenic
1173118874 20:40271317-40271339 CACTTGTAGCAATTTCCTGGGGG - Intergenic
1173763773 20:45587648-45587670 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1173781729 20:45762052-45762074 CACTTGAAGCAAGATCCTGATGG - Intronic
1174024734 20:47564480-47564502 AACTTGATGCAAGCTCCTTGAGG - Intronic
1174657223 20:52181699-52181721 TATTTTTAACAAGCTCCTGGGGG - Intronic
1175200234 20:57271787-57271809 CACTTCTAACTAGCTCCTGGGGG + Intergenic
1175715072 20:61249921-61249943 CATTTTTAACAAGCTCCTGGGGG + Intergenic
1177031170 21:15983243-15983265 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1177063011 21:16396786-16396808 CACGTGGAGCAACATCCTGGGGG + Intergenic
1177100626 21:16894435-16894457 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1177102676 21:16916247-16916269 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1177119569 21:17123752-17123774 CCCTTGTAGCAAGCTCCTGGGGG - Intergenic
1177840742 21:26231491-26231513 AGCTTGTAGCAAGCTCCTGGGGG + Intergenic
1178001203 21:28163473-28163495 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1179015279 21:37590462-37590484 CACTTGTAGCATGCTCCCGGGGG + Intergenic
1179387559 21:40957209-40957231 CATGTGTAGCAAGCTCCTGGGGG - Intergenic
1179650364 21:42804478-42804500 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1180001989 21:44999292-44999314 CACGTGTAGCAGGCACCTGCAGG + Intergenic
1182113952 22:27744242-27744264 CATAGGTAGCAAGCTCCTGTGGG - Intergenic
1182732277 22:32505036-32505058 CGCGTGTAGCAAGCTCCTGGGGG - Intergenic
1182998607 22:34836572-34836594 CACTTGTAGCAAGCTCTTGGAGG - Intergenic
949162090 3:894120-894142 CACTTGTAGCAAGCTCCTGTGGG + Intergenic
949671156 3:6399938-6399960 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
949827444 3:8179275-8179297 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
950325985 3:12110394-12110416 CACTTGGTGCAAGCTGTTGGTGG + Intronic
950926497 3:16746576-16746598 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
951298808 3:20970963-20970985 CACTTGTAGCAACCTCCTTGGGG + Intergenic
951316314 3:21192650-21192672 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
951332325 3:21382014-21382036 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
951762793 3:26163821-26163843 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
951888975 3:27551579-27551601 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
952343559 3:32464861-32464883 CACTTGTAGCAAGCTCCTGGGGG + Intronic
952663455 3:35877776-35877798 CTCTTGTAGAAAGCTCCTGGGGG + Intergenic
952895211 3:38074115-38074137 CACTTGAAGCAGGATCCTGATGG + Intronic
952896054 3:38079731-38079753 CACTCGTAGCAAGCTCCTGGGGG + Intronic
953077132 3:39581251-39581273 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
953177194 3:40563238-40563260 CACTTGTAGCAAGCTCCTGGGGG - Intronic
953448153 3:42984980-42985002 CTCTCGAGGCAAGCTCCTGGTGG + Intronic
953599438 3:44348474-44348496 CACTTGAAGCAAGATCCTGGGGG + Intronic
953656563 3:44859135-44859157 CACTTTAAGCAAGCTCCTGTGGG + Intronic
953825698 3:46249742-46249764 CACTTGTAGCAAGCTCCTCGGGG + Intronic
953834473 3:46330851-46330873 CACTTGAAGCAAGATCCTGGAGG + Intergenic
953841162 3:46391189-46391211 CACTTGAAGGAAGATCCTGGGGG + Intergenic
954161763 3:48727780-48727802 CATTTGAAGCAAGATCCTGATGG + Intronic
954933705 3:54307369-54307391 CACCTGCTGCAATCTCCTGGAGG + Intronic
954969266 3:54637934-54637956 CATGTGTAGCAAGTTCCTGGGGG + Intronic
955021788 3:55128764-55128786 CACTTGGTGAAAGCACCTGGGGG - Intergenic
955253367 3:57305937-57305959 CACTTGTAGCAAGCTCCTGGGGG - Intronic
956306445 3:67831857-67831879 CACATGGAGCAAGCTGTTGGTGG - Intergenic
956335569 3:68159658-68159680 CTCTTGAGGCAACCTCCTGGTGG - Intronic
956548987 3:70438314-70438336 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
956630484 3:71312108-71312130 CACCTTTAGCAAGCCCTTGGTGG - Intronic
956709219 3:72025247-72025269 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
957059898 3:75473483-75473505 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
957201566 3:77142740-77142762 CCCTTGTAGCAAGCTCTAGAGGG - Intronic
957295236 3:78326061-78326083 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
957317311 3:78586598-78586620 CATATGTAGCAAGCTCCTGGGGG + Intergenic
957394369 3:79620072-79620094 CACTTGAAGCAAGATCTTGAGGG - Intronic
957451439 3:80387139-80387161 CACTTGAAGCAAGATCCTTTGGG - Intergenic
957675250 3:83356572-83356594 AACTTGAAGTAAGATCCTGGGGG + Intergenic
957734862 3:84191253-84191275 CCCTTGAAGCAAGATCCTGATGG + Intergenic
957904843 3:86541833-86541855 CACTTGAAGTAAGATCCTGCGGG + Intergenic
958421956 3:93940059-93940081 CACTTGAAGCAAGATCCTGGGGG - Intronic
959288350 3:104443370-104443392 CACGTGTAGCAAGCTCTTGGGGG + Intergenic
959485773 3:106926181-106926203 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
959972266 3:112421016-112421038 CACGTGTAGCAAGCTCCTGGGGG + Intergenic
960011227 3:112835896-112835918 CACTTGTTCCCAGCTCCTGTTGG + Intronic
960083053 3:113561681-113561703 AATTTTTAGCAAGCTGCTGGGGG - Intronic
960282876 3:115796957-115796979 CACGTGTAGCAAGCTCCTGGGGG + Intergenic
960310113 3:116108770-116108792 CACTTGTAGCAAGCTCCTGGGGG + Intronic
961164761 3:124756004-124756026 TACGTGTAGCAAGCTCCTGGGGG + Intergenic
961293511 3:125865962-125865984 CACTAGTAGCAAGCTCCTGGGGG - Intergenic
961711624 3:128832643-128832665 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
961730588 3:128961964-128961986 CACTTGTAGCAAGCTCCTGGGGG - Intronic
961881048 3:130061531-130061553 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
962022186 3:131512559-131512581 CACTTAAAGCAAGATCCTGGGGG + Intergenic
962205567 3:133431387-133431409 CACTTGAAGCAAGCTCCTGGGGG - Intronic
962660634 3:137597732-137597754 CACCTTTAGCAAGCTCCTGGGGG - Intergenic
962712794 3:138101744-138101766 CACCTATAGGAAGCTGCTGGAGG - Intronic
963058624 3:141207222-141207244 CACTTGTAGGAAGCTCCTGGGGG - Intergenic
963111839 3:141694738-141694760 CACTTGAAGCAAGATCCTGGGGG + Intergenic
963425218 3:145115238-145115260 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
963456660 3:145554627-145554649 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
963468615 3:145712656-145712678 CACTTGTAGCAAGCTCCTAGGGG - Intergenic
963483191 3:145903630-145903652 CACTTGTCCCCAGCTCCTGCAGG - Intergenic
963520450 3:146355806-146355828 CACTTGTAGCAAGCTCCTAGGGG - Intergenic
963521625 3:146364311-146364333 CACTTGTAGCAAACTCCTGGGGG - Intergenic
963663345 3:148153909-148153931 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
963684332 3:148416606-148416628 CACATGTAGCAAGCTCCTGGGGG - Intergenic
963936015 3:151054446-151054468 CACTCCTAACAAGCTCCTGCAGG - Intergenic
964067875 3:152599598-152599620 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
964125452 3:153230145-153230167 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
964300252 3:155278634-155278656 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
964906512 3:161725313-161725335 CACTTGTAGCAAGCTTCTAGGGG + Intergenic
964983636 3:162714660-162714682 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
964984870 3:162725975-162725997 CACTTGTAGCAAGCTACTGGGGG + Intergenic
965070330 3:163909801-163909823 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
965105228 3:164345571-164345593 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
965262651 3:166504237-166504259 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
965263076 3:166507980-166508002 TAGTTGTAGCAAGGTCCTGCTGG + Intergenic
965286731 3:166827555-166827577 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
965335105 3:167424850-167424872 CACTTGAAGCAAGATCCTGATGG - Intergenic
965336329 3:167433473-167433495 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
965626309 3:170686776-170686798 CACTTGTAGCAAGCTCCTGGGGG + Intronic
965713409 3:171578672-171578694 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
965861969 3:173159360-173159382 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
965979295 3:174667662-174667684 CTCTTGAGGCAATCTCCTGGTGG + Intronic
966066845 3:175829972-175829994 CACTTGTAGCAAGCTCCTGCGGG - Intergenic
966085432 3:176063593-176063615 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
966105084 3:176325075-176325097 CACTTGCAGCAAGCTCCTGGGGG + Intergenic
966232847 3:177669291-177669313 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
966279304 3:178209790-178209812 CACTTGTAGGAAGCTCCTGGGGG - Intergenic
966398447 3:179524385-179524407 CACTTGAAGCAAGATCCTGATGG + Intergenic
967212165 3:187178981-187179003 CACGTGTAGCAAGCTCCTGTGGG + Intronic
967244166 3:187469723-187469745 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
967385547 3:188907350-188907372 CTCTTGTAGCAAGATCTTGATGG - Intergenic
967496222 3:190146763-190146785 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
967561385 3:190922363-190922385 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
967643829 3:191898821-191898843 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
967740486 3:192997941-192997963 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
968993384 4:3929636-3929658 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
969003811 4:4003668-4003690 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
969076082 4:4578817-4578839 CACTTCTAACAAGCTCCCAGAGG + Intergenic
969749056 4:9096517-9096539 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
969810116 4:9641157-9641179 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
970029233 4:11657185-11657207 CACATGTAGCAAGCTCCTGGGGG + Intergenic
970042091 4:11808531-11808553 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
970087548 4:12366020-12366042 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
970256421 4:14173982-14174004 TACTTGTAGCAAGCTCCTGGGGG + Intergenic
970300483 4:14676471-14676493 CATTTGTCACAAGCTCCTTGAGG + Intergenic
970532736 4:16999920-16999942 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
970854046 4:20633751-20633773 CACTTGTAGCAAGCTCCTGTGGG + Intergenic
971123183 4:23725478-23725500 CACTTGTAGCAAGCTCCTGTGGG + Intergenic
971180564 4:24325468-24325490 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
971200141 4:24503265-24503287 CACTTGTAGCAAGCTCCTGTGGG - Intergenic
972054970 4:34790205-34790227 CACTTGTAACAAGCTCCTGCAGG + Intergenic
972070813 4:35018209-35018231 CACTTGAAGCAAGATCCTAGGGG + Intergenic
972071137 4:35020238-35020260 CACTTGAAACAAAATCCTGGGGG + Intergenic
972648245 4:40990611-40990633 GAGTTGTGGCAAGCTCATGGGGG + Intronic
972665933 4:41165634-41165656 CTCTTGAGGCAACCTCCTGGTGG - Intronic
974428398 4:61767744-61767766 CATGTGTAGCAAGTTCCTGGGGG + Intronic
974903777 4:68032871-68032893 CACGTGAAGCAAGATCCTGAGGG - Intergenic
975865088 4:78717314-78717336 CACGTGTAGCAAGCTCCTGTGGG + Intergenic
975933887 4:79557433-79557455 CATGTGTAGCAAGCTCCTGTGGG + Intergenic
976057219 4:81082228-81082250 CACATGTGGTAAGGTCCTGGTGG + Intergenic
976218033 4:82732905-82732927 CATTTCTAGCAAGTTCCAGGTGG - Intronic
976558571 4:86476845-86476867 CACTTGTAGCAAGCTCCTGGGGG - Intronic
976696538 4:87924123-87924145 CACATGTAGCAAGCTCCTGTGGG - Intergenic
976739957 4:88347203-88347225 CACTTGAAGCAAGATCCTGGGGG + Intergenic
976884571 4:89968248-89968270 AACTTGTAGCAAGCTCCTCGGGG + Intergenic
977012924 4:91658078-91658100 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
977062508 4:92274946-92274968 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
977075205 4:92442417-92442439 CAAGTGTAGCAAGCTCCTTGGGG + Intronic
977198427 4:94088080-94088102 TACTTGTAGCAAGCTCCTGTGGG + Intergenic
977217154 4:94296671-94296693 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
977225342 4:94386924-94386946 CACTTGTAGCAAGCTCCTGTGGG + Intergenic
977782438 4:100995235-100995257 CACTTGAAGCAAGTTCCCGGGGG + Intergenic
977952796 4:102993538-102993560 CACATGGTGCAAGCTGCTGGTGG + Intronic
978001119 4:103557219-103557241 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
978031484 4:103943396-103943418 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
978303229 4:107293876-107293898 CACTTGAAGCAAGATCCTGGGGG + Intergenic
978438611 4:108711282-108711304 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
979054622 4:115979109-115979131 CAATTATAGGAAGCTCCTGGGGG + Intergenic
979379942 4:119996176-119996198 CACATGCAGCAAGCTCCTGTGGG - Intergenic
980003352 4:127514902-127514924 CACTTGTAACAAGCTCCTGGGGG + Intergenic
980111926 4:128644310-128644332 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
980284947 4:130769615-130769637 CACTTGTAGCAAGTTTCTGGGGG - Intergenic
980388925 4:132120455-132120477 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
980472441 4:133267148-133267170 CATGTGTAGCAAGCTCCTGGGGG + Intergenic
980491350 4:133532613-133532635 CACTTGAAGAAAGATCCTGATGG + Intergenic
980527869 4:134014429-134014451 CACTTGTAGCAAGTTCCTGGGGG - Intergenic
980575636 4:134681362-134681384 CACTTGTAGCAAGCTACTGGGGG + Intergenic
980611776 4:135170746-135170768 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
980903938 4:138930126-138930148 CACTTGTAGCAAGCTACTGGGGG - Intergenic
981040244 4:140215749-140215771 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
981139259 4:141249410-141249432 CACTAGTAGCAAGTTCATGTAGG - Intergenic
981482727 4:145255001-145255023 AACTTGAAGCAAGATCCTGGGGG + Intergenic
981525210 4:145701355-145701377 CACTTGTAGCAAGCTCCTGGGGG - Intronic
981539725 4:145835000-145835022 CACGTGTAGCAAGCTCCTGTGGG - Intronic
982051129 4:151503433-151503455 CTCTTGAGGCAATCTCCTGGTGG + Intronic
982083967 4:151816058-151816080 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
982180481 4:152744788-152744810 CACTTGAAGCAGGATCCTGATGG + Intronic
982318810 4:154058535-154058557 CACTTGAAGCAAGATCCTGAGGG - Intergenic
982396718 4:154922294-154922316 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
982414196 4:155111917-155111939 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
982497104 4:156106922-156106944 CACTTGTAGCAAGCTCCTGCAGG + Intergenic
982535447 4:156602537-156602559 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
983055488 4:163095343-163095365 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
983345556 4:166522777-166522799 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
983360407 4:166718555-166718577 CATGTGTAGCAAGATCCTGTGGG - Intergenic
983414708 4:167439260-167439282 CAAGCGTAGCAAGCTCCTGTGGG + Intergenic
983448060 4:167878525-167878547 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
983659572 4:170118709-170118731 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
983707674 4:170679747-170679769 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
983883756 4:172959825-172959847 CACTTGTAGCAAGCTCCTGGAGG + Intronic
984099047 4:175464890-175464912 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
984165356 4:176298304-176298326 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
984279885 4:177657929-177657951 CTCTTGAGGCAATCTCCTGGTGG - Intergenic
984322188 4:178209377-178209399 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
984393614 4:179168345-179168367 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
984411727 4:179405473-179405495 CACTGGAAGCAAGATCCTGGGGG - Intergenic
984700672 4:182816777-182816799 CACATGTAGCAAGCTCCTGTGGG - Intergenic
985057396 4:186047653-186047675 CACTTGTAGCAAGCTCTTGGGGG + Intergenic
985079004 4:186245564-186245586 CACTTGAAACAAGATCCTGATGG + Intronic
985435724 4:189928104-189928126 CACTTGTAGCAAGCTCCTAGTGG - Intergenic
986193536 5:5517810-5517832 CACTTGTAGCAAGCTCCTGTGGG - Intergenic
986368978 5:7061766-7061788 CACCTGAAGCAAGATCCTGATGG + Intergenic
986388880 5:7265840-7265862 CACATGTAGCAAGCTCCTGTGGG - Intergenic
986502639 5:8416351-8416373 CACTTGAAGCAAGATCCTGGGGG - Intergenic
986555042 5:9002001-9002023 CACTTGCAGCAAGCTCCTGGGGG + Intergenic
986919586 5:12665995-12666017 CAGGTGTAGCAAGCTCCTGTGGG + Intergenic
986970014 5:13322438-13322460 CCCTTGTACCAAACTCCAGGAGG + Intergenic
987282040 5:16422269-16422291 CACTTGTAGCAAGCTTCTGGGGG - Intergenic
987486836 5:18535930-18535952 CATGTGTAGCAAGCTCCTGGGGG - Intergenic
987487504 5:18540564-18540586 CACTTGTAGCAATCTCCTGTGGG - Intergenic
987498122 5:18672314-18672336 CATGTGTAGCAAGCTCCTGTGGG + Intergenic
987755832 5:22097099-22097121 CACTTGTAGCAAGCTCCTGAGGG - Intronic
989615157 5:43331394-43331416 CACTTGAAGCAAGATCCTTGAGG + Intergenic
989659925 5:43788370-43788392 CACTTGAAGCAAGATTCTGGGGG - Intergenic
989688901 5:44118190-44118212 CACTTGAAGCAAGATCCTGGGGG + Intergenic
990565124 5:57020436-57020458 CACTTGAAGCAAGATCCTGCAGG + Intergenic
992394662 5:76359609-76359631 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
992607638 5:78475548-78475570 CACCTGTTGCAAACTCCTGTTGG - Exonic
992960830 5:81955513-81955535 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
993175757 5:84482996-84483018 CACTTGTCTCATGCTCCAGGAGG + Intergenic
993192713 5:84700734-84700756 CATGTGTAGCAAGCTCTTGTGGG - Intergenic
993836707 5:92826230-92826252 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
994126108 5:96170332-96170354 CACTTGTAGCAAGCTGCGGGAGG + Intergenic
994295148 5:98081320-98081342 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
994320778 5:98392337-98392359 CACCTGTAGGAAGCTGCTGGAGG - Intergenic
994324875 5:98436823-98436845 CACTTGAGGCAAGTACCTGGGGG - Intergenic
994375786 5:99014763-99014785 CACTTGAAGGGAACTCCTGGGGG + Intergenic
994532545 5:100987709-100987731 CATGTGTAGCAAGCTCCTGGGGG + Intergenic
994556938 5:101317191-101317213 CACTTGTAGCAAGCTCCTCGGGG - Intergenic
994775684 5:104033872-104033894 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
994989553 5:106980635-106980657 CACTTGTAGCAAGCTCATGGGGG - Intergenic
995125161 5:108571912-108571934 CACTTGTAGCAAGCTCTTGGGGG + Intergenic
995296676 5:110532096-110532118 CACTTGTAGCAAGCTCCTGGGGG - Intronic
995769383 5:115652786-115652808 CACTTGAAACAATCTCCTGGGGG - Intergenic
995899365 5:117049820-117049842 CACTTGTAGCAAGCTCCTGTGGG + Intergenic
996052675 5:118950663-118950685 CACTTGAAGCAAGATCCTGGGGG + Intronic
996203258 5:120701046-120701068 CACATGTAGCAAGCTCCTGTGGG + Intergenic
996344821 5:122477060-122477082 CACATGTAGCAAGCTCCTGTGGG + Intergenic
996358623 5:122622323-122622345 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
996509899 5:124306048-124306070 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
996528054 5:124499309-124499331 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
996574998 5:124970055-124970077 CACTTGTAGCAAGCTGGGGGAGG + Intergenic
996745446 5:126843014-126843036 CAAGTGTAGCAAGCTCCTGTGGG + Intergenic
996912447 5:128670676-128670698 CCCTTGTAGCAGGCTCCTGGGGG + Intronic
996917681 5:128731801-128731823 CACTTGAAGCAAGATCCTGGGGG - Intronic
997299565 5:132792638-132792660 AGCTTCTAGGAAGCTCCTGGTGG - Intronic
997678862 5:135735130-135735152 CACTTGAAGCAAGTTCCTTGGGG + Intergenic
997746401 5:136303568-136303590 CACTTGTAGCAAGCTCCTGGGGG - Intronic
997770627 5:136549776-136549798 CACTTGAAGCAAGATCCTGTTGG + Intergenic
997772644 5:136568803-136568825 CACATGTAAAAAGCTCCTGGGGG + Intergenic
998482259 5:142472649-142472671 TGCTTGTAGGAAGCTTCTGGGGG - Intergenic
998693703 5:144614793-144614815 CACATGTAGCAAGCTCTTGGGGG + Intergenic
998995391 5:147865530-147865552 CACGTGTAGCAAGCTCCTCTGGG - Intergenic
999618870 5:153453165-153453187 CACGTGTAGCAAGCTTCTGGGGG + Intergenic
1000438586 5:161242222-161242244 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1000519405 5:162278832-162278854 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1000606930 5:163336279-163336301 CACTTGAGGCAAGATCCTGGGGG - Intergenic
1000885321 5:166742546-166742568 CATGTGTAGCAAGCTCCTGGGGG + Intergenic
1000935642 5:167301343-167301365 CACTTGTAGCAAGCTCCTGGGGG + Intronic
1001331449 5:170765489-170765511 CACTTGTAGCAAGCTCCTGGGGG + Intronic
1001435160 5:171694304-171694326 CACTTGTTGGAAGCTTCTTGGGG + Intergenic
1002610960 5:180418181-180418203 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1003099741 6:3168127-3168149 CACTTGAAACAAGATCCTGATGG - Intergenic
1003430166 6:6031238-6031260 CACTTGTAGTAAGCTCCTGGGGG + Intergenic
1003911672 6:10749053-10749075 CACTGGTACCAATTTCCTGGGGG - Intronic
1004106267 6:12669632-12669654 CACTTGTGGCAAGCTCCTGTGGG - Intergenic
1004283523 6:14300407-14300429 GATATGTAGCAAGCTCCTCGGGG + Intergenic
1004507996 6:16262448-16262470 CACTTGTAGCAAGCTCCTGGGGG + Intronic
1004575224 6:16888211-16888233 CACTTGTAGCAAGCTCCTGGAGG - Intergenic
1004768574 6:18757521-18757543 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1004837002 6:19541159-19541181 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1005014657 6:21364963-21364985 CACATGTAGCAAGCTCCTGTGGG + Intergenic
1005786574 6:29250662-29250684 CACTTGAAGCAAGATCCTGGGGG + Intergenic
1007300983 6:40867662-40867684 CACTTGAAGCAAGATCCTGTTGG + Intergenic
1008476526 6:51940438-51940460 CACTTGTAGTAAGCTCCTGGGGG - Intronic
1008850213 6:56014270-56014292 CACTTGTAGCAAGCTCCTTGGGG + Intergenic
1009359357 6:62793759-62793781 CACTCGTAGCAAGCTCCTGAGGG - Intergenic
1009379145 6:63007569-63007591 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1009405500 6:63307422-63307444 AAGCTGTAGCAAGGTCCTGGAGG + Intronic
1009464337 6:63952161-63952183 CACTTGAAGCAAGATCCTGATGG - Intronic
1010071724 6:71752003-71752025 CACTTGTAGCAAGTTCCTGGGGG + Intergenic
1010497892 6:76557912-76557934 CTCTTGAGGCAATCTCCTGGTGG - Intergenic
1010586696 6:77664011-77664033 CACATGTAGCAAGCTCCTGTGGG + Intergenic
1010826912 6:80485893-80485915 CACTTGTAGCAAACTCCTGGGGG + Intergenic
1010829690 6:80513761-80513783 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1010841314 6:80651253-80651275 CACTTCTAGCAAGCTCCTGGGGG + Intergenic
1010894545 6:81348593-81348615 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1011770944 6:90673668-90673690 CAAGTGTAGCAAGCTCCTGGGGG + Intergenic
1012014390 6:93833534-93833556 CAAGTGTAGCAAGCTCCTGCGGG + Intergenic
1012066543 6:94557400-94557422 CAAGTGTAGCAAGCTCCTGCGGG + Intergenic
1012315826 6:97781853-97781875 CACAGGTAGCAAGCTCCTGTGGG - Intergenic
1012675099 6:102104211-102104233 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1012689575 6:102295180-102295202 CACGTGTAGCAGGCTGCTGTGGG - Intergenic
1013407888 6:109859211-109859233 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1013808085 6:114015768-114015790 CACTTGAAGCAAGAACCTGGGGG + Intergenic
1013843681 6:114425779-114425801 CATGTGTAGCAAGCTCCTGGGGG + Intergenic
1013891703 6:115034135-115034157 CATGTGTAGCAAGCTCCTGGGGG - Intergenic
1014042998 6:116851014-116851036 CACATGGTGCAAGCTGCTGGTGG - Intergenic
1014115340 6:117663141-117663163 CACTTGAAGTAAGATCCTGGAGG + Intergenic
1014360160 6:120465722-120465744 CATGTGTAGCAAGCTCCTGGGGG + Intergenic
1014396069 6:120927444-120927466 CACTTGTAGCAAGCTCCTGTGGG - Intergenic
1014454871 6:121623895-121623917 CACATGTAGCAAGCTCCTGTGGG + Intergenic
1014555848 6:122842083-122842105 CATGTGTAGCAAGCTCCTGTGGG - Intergenic
1014612084 6:123558896-123558918 CACTTGTGGCAAGGTCCTGGGGG - Intronic
1014614673 6:123585744-123585766 CACTTGTAGCAAGCTCCTGGGGG + Intronic
1014679862 6:124415210-124415232 TGCTAATAGCAAGCTCCTGGTGG + Intronic
1014718896 6:124894291-124894313 CACATGTAGCAAGCTCCTGTGGG - Intergenic
1014793991 6:125705317-125705339 CACATGTAGCAAGCTCCTGGGGG + Intergenic
1014891544 6:126851008-126851030 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1015266735 6:131297710-131297732 CACATGTAGCAAGCTCCTGGGGG - Intergenic
1015269657 6:131325657-131325679 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1015278153 6:131405067-131405089 CACATGTAGCAAGCTCCTGGGGG - Intergenic
1015288041 6:131507738-131507760 CACGTGTAGCAAGCTCCTGTGGG + Intergenic
1015323830 6:131903940-131903962 CACGTGTAGTAAGCTCCTGTGGG - Intergenic
1015801377 6:137064781-137064803 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1016114141 6:140260866-140260888 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1016248862 6:142018062-142018084 CACATGTAGCAAGCTCCTGTGGG - Intergenic
1016518806 6:144925426-144925448 CATGTGTAGCAAGCCCCTGGGGG - Intergenic
1016535759 6:145106605-145106627 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1016650291 6:146453871-146453893 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1016853269 6:148642054-148642076 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1017269814 6:152492468-152492490 CACTTGAAGCAAGATCCTGGGGG - Intronic
1017389498 6:153923739-153923761 CACGGGTAGCAAGCTCCTGGGGG - Intergenic
1017779331 6:157704103-157704125 CACTTGTAGCAACCTCCTGGGGG + Intronic
1017806027 6:157946246-157946268 CATCTGTAGCAAGCTACTTGAGG + Intergenic
1018077597 6:160230749-160230771 CACTTGTAGCAAGCTCCTGGGGG - Intronic
1018495401 6:164342189-164342211 CACTTGTAGCAAGCTCCTGGTGG + Intergenic
1018521467 6:164655607-164655629 CACCTGTAGCAAGCTCCTGGAGG + Intergenic
1019778168 7:2924580-2924602 CACTAAGAGGAAGCTCCTGGAGG - Intronic
1020316050 7:6906044-6906066 CACTTGTAGCAAGCTCTTGGGGG - Intergenic
1020532714 7:9356875-9356897 CATGTGTAGCAAGCTCCTGGGGG + Intergenic
1020541141 7:9462011-9462033 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1021172672 7:17416097-17416119 CACTTGAAGCAAGGTCCTAATGG - Intergenic
1021429849 7:20547703-20547725 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1021637317 7:22705498-22705520 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1021660625 7:22915373-22915395 CACTTGAAGCAAGATCCTGGGGG - Intergenic
1021810663 7:24398531-24398553 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1021977895 7:26027643-26027665 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1022372873 7:29787101-29787123 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1022447405 7:30481486-30481508 CACTTGAAGCAAGATCCTGATGG - Intergenic
1022572792 7:31470483-31470505 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1022710046 7:32841359-32841381 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1022799398 7:33761377-33761399 CTTTTCTATCAAGCTCCTGGGGG + Intergenic
1022854709 7:34303348-34303370 CACTTGTAGCAAGTTCCTGGGGG + Intergenic
1022977847 7:35575174-35575196 CATCTGTAGGAAGCTCGTGGTGG + Intergenic
1023698886 7:42874063-42874085 CACTTGTAACAAGTTCCTGGGGG + Intergenic
1024739253 7:52337101-52337123 CACTTGAAGCAAGATCCTGGGGG + Intergenic
1025790107 7:64680938-64680960 CACTTGAAGCATGGCCCTGGAGG - Intronic
1026252844 7:68685789-68685811 TAATTGCAGCCAGCTCCTGGTGG + Intergenic
1026489615 7:70851408-70851430 CACCTGCAGCAAACCCCTGGTGG + Intergenic
1027158316 7:75784183-75784205 CACTTATAGCAAGCTCCTGGGGG - Intronic
1027851945 7:83461919-83461941 CACATGTAGCAAGCTCCTGGGGG - Intronic
1028589910 7:92483244-92483266 CACTTGAAGCAAGATCCTGGGGG + Intergenic
1028670510 7:93396185-93396207 CACTTGCAGCAAGCTCCTGGGGG - Intergenic
1028690178 7:93642115-93642137 CACTTGCAGCAAGCTCCTGGGGG - Intronic
1029500214 7:100924424-100924446 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1029532777 7:101136552-101136574 CATTGCTACCAAGCTCCTGGAGG + Intronic
1029803750 7:102975948-102975970 CACTTGAAGCAGGCACCAGGTGG - Intronic
1030441687 7:109595482-109595504 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1030445783 7:109645574-109645596 CACTTGAAGCAAGATCCTGGGGG + Intergenic
1030751498 7:113237034-113237056 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1030947301 7:115739482-115739504 CACTTGTAGCATTCTCCAGAGGG - Intergenic
1031004668 7:116457738-116457760 CACGTGTAGCAAGCTCCTGGGGG - Intronic
1031364746 7:120889068-120889090 CACCTGTAGCAAGCTCCTGGGGG + Intergenic
1031399985 7:121317826-121317848 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1031422455 7:121567435-121567457 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1031525592 7:122819175-122819197 CACATGTAGCAAGCTCCTGTGGG - Intronic
1031685846 7:124731293-124731315 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1031727932 7:125262358-125262380 CACTTATAGCAAGCTCCTGGGGG + Intergenic
1031776324 7:125912243-125912265 CACATGTAGCAAGTTCCTGTGGG - Intergenic
1031777344 7:125919868-125919890 CACTTGTAGCAAGCTCTTGGGGG - Intergenic
1033088557 7:138364805-138364827 CACTTGAAGCAAGATCCTGGGGG - Intergenic
1033211520 7:139463546-139463568 CACTTGAAGCAAGATCCTGGTGG - Intronic
1033465034 7:141582241-141582263 CACTTGAAGCAAGTTCCTGGGGG + Intronic
1033625587 7:143107076-143107098 CACTTGAAGCAAGATCCTGGGGG - Intergenic
1033675951 7:143540678-143540700 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1033695884 7:143788761-143788783 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1033909468 7:146246835-146246857 CACTTGTAGCAAGCTCCTGGGGG + Intronic
1034084833 7:148313506-148313528 CACTTGTAGCAAGCTCCCGGGGG + Intronic
1035880664 8:3241672-3241694 CACTTGTAGCAAGCTCCTGGGGG + Intronic
1035908408 8:3538791-3538813 CACTTGCACCAAGAGCCTGGTGG + Intronic
1036070923 8:5440097-5440119 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1036142664 8:6222847-6222869 CATTTATAACAAGCTCCTAGGGG + Intergenic
1036281482 8:7404692-7404714 CATATGTAGCAAGCTCCTGGGGG - Intergenic
1036339987 8:7906880-7906902 CATATGTAGCTAGCTCCTGGGGG + Intergenic
1036472330 8:9062891-9062913 CACTTGTAGCAAGCTCCTGGGGG + Intronic
1040017319 8:42710193-42710215 CACTTATAGTCAGCTCCTTGGGG + Intronic
1041172966 8:55164137-55164159 CGCTTGGAGCAAACTCCTGTAGG - Exonic
1041651840 8:60309956-60309978 CACTTGAAGCAAGATCCTGATGG + Intergenic
1041917534 8:63151753-63151775 CACTTGAAGCAAGATCCTGGGGG + Intergenic
1042453557 8:68975426-68975448 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
1042653379 8:71067966-71067988 CACTTATAGCAAGCGACTTGTGG - Intergenic
1042706082 8:71666659-71666681 CACTTGAAGCAAGATCTTGGGGG - Intergenic
1042707369 8:71677166-71677188 CGCGTGTAGCAAGCTCCTGGGGG - Intergenic
1043353671 8:79389561-79389583 CACGTGTAGCAAGCTCCTGGGGG + Intergenic
1043597455 8:81901993-81902015 CACTTGAAGCAAGATCCTGGGGG + Intergenic
1043717897 8:83508597-83508619 TAGTTGTGGCAAGCTCCTGGGGG + Intergenic
1043720906 8:83546224-83546246 CACTTGAAGCAAGATCCTGGGGG - Intergenic
1043737869 8:83769357-83769379 CACCTGTACCAGGCTCCTGTGGG + Intergenic
1043837737 8:85065227-85065249 CACTTATAGCAAGCTCCTGGGGG - Intergenic
1044148517 8:88745671-88745693 CACGTGTAGCAAGCTCTTGGGGG + Intergenic
1044258615 8:90093660-90093682 CACTTGTAGCAAGCTCCTGGGGG + Intronic
1044417084 8:91950222-91950244 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1044921991 8:97177329-97177351 CACATGTAGCAAGCTCCTGGGGG - Intergenic
1044925158 8:97203173-97203195 CATGTGTAGCAAGCTCCTGGGGG - Intergenic
1045197521 8:99946124-99946146 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
1045644781 8:104288188-104288210 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1046074908 8:109303065-109303087 CACTTGAAGCAAGATCCTTGGGG - Intronic
1046140310 8:110083015-110083037 CACCTGTTGCCAGCTCCTGCTGG - Intergenic
1046294119 8:112198077-112198099 CACTCGTAGCAAGCTCCTGGGGG - Intergenic
1046386342 8:113512969-113512991 CATGTGTAGCAAGCTCCTGTGGG + Intergenic
1046440012 8:114243591-114243613 CACGTGTCGCAAGCTCCTGGGGG - Intergenic
1046443247 8:114284246-114284268 CACGTGTAGCAAGTTCCTGTGGG - Intergenic
1046512084 8:115214480-115214502 CATGTGTAGCAAGCTCCTGTGGG - Intergenic
1046559283 8:115816862-115816884 CACTTGTAGCAAGCTCCTGGAGG - Intergenic
1047699346 8:127433982-127434004 CACATGTAGCAAGCTCCTGGGGG - Intergenic
1047829544 8:128615364-128615386 TACTTGTAGCAAGCTTCTAGGGG + Intergenic
1047856373 8:128916673-128916695 CATTTGTGGCAAGCTCCTGGGGG - Intergenic
1048143772 8:131821439-131821461 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1048168433 8:132083693-132083715 CACATGTAGCAAGCTCCTGTGGG + Intronic
1048585420 8:135770597-135770619 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1048728420 8:137411731-137411753 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1048764236 8:137828272-137828294 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1049213324 8:141396587-141396609 CACTTGGCGCCAGCTCCTCGGGG - Intronic
1049868818 8:144957715-144957737 CACCTGTAGCAAGCTCCTGGGGG + Intergenic
1050117602 9:2277821-2277843 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1050140481 9:2511688-2511710 CACTTGAAGCAAGATCCTGTGGG - Intergenic
1050258107 9:3814607-3814629 CACTTGTAGCAAGCTTCTGGGGG + Intergenic
1050896074 9:10887021-10887043 CACTTACAGCAAGCTCCTGGGGG - Intergenic
1051052626 9:12950576-12950598 CACATGTAGCAAGCTCCTGTGGG - Intergenic
1051849285 9:21489157-21489179 CACTTGCAGCAAACTCCTGGGGG + Intergenic
1051953406 9:22662023-22662045 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1052163083 9:25289927-25289949 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1052191836 9:25671181-25671203 CACTTATAGCAAGCTCTTGAGGG - Intergenic
1052218898 9:25996939-25996961 CACTTGAAGCAAGGCCCTGGAGG - Intergenic
1052653334 9:31328669-31328691 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1052720641 9:32167967-32167989 CACTTGCAGCAAGCTCCTGGGGG + Intergenic
1052759622 9:32577009-32577031 CTCTTGAGGCAATCTCCTGGTGG + Intergenic
1053058032 9:35005743-35005765 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1053059921 9:35022763-35022785 CACTTGAAGCAAGATCCTGGGGG + Intergenic
1053078461 9:35154688-35154710 CACTTGAAGCAAGATCCTGAGGG + Intergenic
1053534224 9:38910226-38910248 CACCTGTAGCTAACTCCAGGTGG - Intergenic
1054206448 9:62134645-62134667 CACCTGTAGCTAACTCCAGGTGG - Intergenic
1054631910 9:67453701-67453723 CACCTGTAGCTAACTCCAGGTGG + Intergenic
1054807488 9:69408208-69408230 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1055233062 9:74087918-74087940 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
1055347718 9:75355236-75355258 CACTTGTGGCAAGCTCCTGGGGG + Intergenic
1055626722 9:78183062-78183084 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1055810046 9:80139666-80139688 CACATGTAGCAAGCTCCTGGGGG - Intergenic
1055881747 9:81011262-81011284 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1055920399 9:81454018-81454040 GAGTTGAAGCAAGCTCCTTGAGG - Intergenic
1056044737 9:82704167-82704189 CACTTGTAGCAAGCTCCTAGGGG + Intergenic
1056061159 9:82886012-82886034 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1056113992 9:83424113-83424135 CATTTCTAACAAGCTCCAGGTGG + Intronic
1056323885 9:85460901-85460923 CACGTGTCGCAAGCTCCTGGGGG - Intergenic
1056522447 9:87413181-87413203 CATGTGTCGCAAGCTCCTGTGGG - Intergenic
1056882980 9:90414830-90414852 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1056886854 9:90451094-90451116 GTCATGTAGCAAGCCCCTGGTGG - Intergenic
1057234846 9:93349860-93349882 CACGTGTAGCAAGCTCCTGGGGG - Intergenic
1057377993 9:94542082-94542104 CACTTGTAGCAAGCTCCTTGGGG - Intergenic
1057626912 9:96686173-96686195 CACTTGCAGGAAGCTCTTTGTGG + Intergenic
1057684002 9:97217098-97217120 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1057812581 9:98269266-98269288 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1057982083 9:99672414-99672436 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1058026207 9:100144149-100144171 CACTTGTAGCAAGCTTCTTGGGG + Intronic
1058612402 9:106790452-106790474 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1059345785 9:113626988-113627010 CACTTGCAGCAGACTCCAGGAGG + Intergenic
1059546158 9:115178075-115178097 CACTTGTAGCAAGCTCCTGGGGG + Intronic
1059606707 9:115842660-115842682 CAAGTGTAGCAAGCTCCTGTGGG + Intergenic
1059863486 9:118489129-118489151 CAAGTGTAGCAAGCTCCTGTGGG + Intergenic
1060057236 9:120425203-120425225 GAGTTGTTGCAAGCTCCTCGAGG - Intronic
1060226197 9:121792579-121792601 CACTTGAAGCAAGATCCTGATGG - Intergenic
1060318468 9:122534089-122534111 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1060737883 9:126078083-126078105 CACTTGTAGCAAGCGCCTGGGGG + Intergenic
1061583067 9:131549341-131549363 CACTCGTAGCAAGCTCCTGGGGG - Intergenic
1061773785 9:132946925-132946947 CTCTTCTTGCAAGCCCCTGGTGG - Intronic
1062731874 9:138114458-138114480 CAGATGCAGCAGGCTCCTGGAGG + Exonic
1185858429 X:3556579-3556601 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1185960687 X:4543939-4543961 CACTTGTAGCAAGCTCCTGTGGG + Intergenic
1185991061 X:4893847-4893869 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1186112864 X:6275633-6275655 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1186683148 X:11896909-11896931 CATTTCTAGCAAGCTCCCAGGGG + Intergenic
1186784068 X:12942078-12942100 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1186874549 X:13804161-13804183 CATTTCTAACGAGCTCCTGGAGG + Intronic
1186888098 X:13934935-13934957 CATTTGTAACAAGCTCCCAGTGG - Intronic
1187086522 X:16048142-16048164 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1187099957 X:16182612-16182634 CACTTTTAGCAAGCTCCTGGGGG + Intergenic
1187103767 X:16220276-16220298 CACTTAAAGCAAGCTCCTGGGGG + Intergenic
1187554065 X:20334272-20334294 CACTTCTAACAAGCTCCTAGGGG + Intergenic
1187873515 X:23783651-23783673 CATATTTAGCCAGCTCCTGGGGG - Exonic
1188200967 X:27292598-27292620 CACTAGAAGCAAGATCCTGAGGG + Intergenic
1188333019 X:28896045-28896067 CACTTGTAGCAAGCTCCTGGGGG + Intronic
1188419487 X:29977533-29977555 CACTTGTAGCAAGCTCCTAGGGG - Intergenic
1188431026 X:30105599-30105621 CACTTGTAGCAAGCTCCTAGGGG - Intergenic
1188463373 X:30452549-30452571 CACTTGTGGCAAGCTCCTTTGGG + Intergenic
1188552652 X:31379760-31379782 CACTTGTAGCAAGCTCCTGGGGG - Intronic
1188650110 X:32621847-32621869 CACTTCTAGCAAGTTTCTAGGGG - Intronic
1189031812 X:37459223-37459245 CACTTGAAGCAAGATCCTGATGG + Intronic
1191014195 X:55791761-55791783 CGCTTGAAGCAAGATCCTGGGGG + Intergenic
1191761274 X:64651165-64651187 CACTTGAAGCAAGATCCTGATGG - Intergenic
1192454597 X:71266438-71266460 CACATGAAGCAAGATTCTGGGGG - Intergenic
1192706143 X:73529921-73529943 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1192914130 X:75635720-75635742 CACTAGAAGCAAGATCCTGTGGG + Intergenic
1193885929 X:86984061-86984083 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1193941499 X:87684145-87684167 CACGTGTAGCAAGCTCCTGAGGG - Intergenic
1194186248 X:90776772-90776794 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1194293625 X:92103690-92103712 CATGTGTAACAAGTTCCTGGGGG + Intronic
1194308540 X:92276513-92276535 CACTTGTAGCAAGCTCCTGGGGG + Intronic
1194351290 X:92826747-92826769 CACGTGTAGCAAGCTCCTAGGGG - Intergenic
1194367107 X:93025189-93025211 CACTTGTAGCAAGCTCCTCGGGG - Intergenic
1194412960 X:93578510-93578532 CACTTGTCCCTAGCTCCTGCTGG - Intergenic
1194502981 X:94702273-94702295 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1194542352 X:95190168-95190190 CACATGTTGCAAGCTGTTGGTGG + Intergenic
1194660689 X:96626282-96626304 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1194765585 X:97843532-97843554 CACTTGAAGCAGGCACCAGGTGG - Intergenic
1194822767 X:98527725-98527747 CAAGTGTAGCAAGCTCCTGTGGG + Intergenic
1194873799 X:99162891-99162913 CACTTATAGCAAGCTCCTGGGGG + Intergenic
1195016953 X:100789874-100789896 CACTTGAAGCAAGATCCTGGGGG + Intergenic
1195291155 X:103432983-103433005 CACTTGAAGCAAGTTCCTGGGGG + Intergenic
1195326857 X:103765229-103765251 CACTTGAAGCAAGTTCCTGGTGG + Intergenic
1195841486 X:109180677-109180699 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1196073083 X:111546173-111546195 CACATGTAGCAAGCTCCTGTGGG - Intergenic
1196165545 X:112532872-112532894 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1196220985 X:113112172-113112194 CACTTGTGGCAAGCTCCTGGGGG + Intergenic
1196227217 X:113180254-113180276 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1196300012 X:114042239-114042261 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1196330825 X:114469019-114469041 CACGTGTAGCAAGCTCCTGTGGG - Intergenic
1196341715 X:114604756-114604778 CACGTGTAGCAAGCTCCTGTGGG + Intronic
1196469906 X:116012929-116012951 CACTTACAGCAAGATCCTGAGGG - Intergenic
1196496865 X:116333079-116333101 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1196533540 X:116815918-116815940 CATGTGTAGCAAGTTCCTGGGGG + Intergenic
1196706695 X:118723280-118723302 CACTGGATTCAAGCTCCTGGAGG - Intergenic
1196773853 X:119321219-119321241 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1196992685 X:121346443-121346465 CACTTGTGGCAAGCTCCTGGGGG + Intergenic
1197064917 X:122224291-122224313 CACTTATAGCAAGCTCCTCGGGG - Intergenic
1197352058 X:125392299-125392321 CATGTGTAGCAAGCTCCTGGGGG + Intergenic
1197793639 X:130279291-130279313 CACTTGAAGCAAGATCCTGATGG - Intergenic
1197933083 X:131714328-131714350 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1198599399 X:138267763-138267785 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1198965924 X:142228806-142228828 CACTTGTAGCAAGCTCCTGGGGG - Intergenic
1198983754 X:142427019-142427041 CACTTGTAGCAAGCTCCTGGAGG + Intergenic
1199092210 X:143705472-143705494 CACTTGTACCCAGCTCCTGCAGG - Intergenic
1199576482 X:149317922-149317944 CACTTGTAGCAAGTTCCTCGGGG - Intergenic
1200532838 Y:4358851-4358873 CACTTGTAGCAAGCTCCTGGGGG + Intergenic
1200611143 Y:5328236-5328258 CATGTGTAACAAGTTCCTGGGGG + Intronic
1200659615 Y:5943437-5943459 CACGTGTAGCAAGCTCCTAGGGG - Intergenic
1200675321 Y:6141445-6141467 CACTTGTAGCAAGCTCCTCAGGG - Intergenic
1201061660 Y:10051776-10051798 CACTTGAAGTAAGATCCTGGGGG + Intergenic
1201307505 Y:12563382-12563404 CACTTGAAGCAAGATCCTGGGGG + Intergenic
1201540635 Y:15101693-15101715 CACTTGAAGCAAGATCCTGGGGG + Intergenic
1201581391 Y:15514631-15514653 CATTTGTAGCAAGCTCCTGGGGG - Intergenic
1202076524 Y:21042535-21042557 CACTTCAAGCAAGATCCTGACGG + Intergenic