ID: 1173763774

View in Genome Browser
Species Human (GRCh38)
Location 20:45587655-45587677
Sequence AGCAAGCTCCTGGGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173763763_1173763774 26 Left 1173763763 20:45587606-45587628 CCTGGGCTACGGCATTCCTTGGC No data
Right 1173763774 20:45587655-45587677 AGCAAGCTCCTGGGGGATGCAGG No data
1173763766_1173763774 10 Left 1173763766 20:45587622-45587644 CCTTGGCCTGGTGGCCAGATTTC 0: 158
1: 207
2: 446
3: 128
4: 205
Right 1173763774 20:45587655-45587677 AGCAAGCTCCTGGGGGATGCAGG No data
1173763769_1173763774 -4 Left 1173763769 20:45587636-45587658 CCAGATTTCTGGCACTTGTAGCA 0: 218
1: 212
2: 194
3: 173
4: 177
Right 1173763774 20:45587655-45587677 AGCAAGCTCCTGGGGGATGCAGG No data
1173763768_1173763774 4 Left 1173763768 20:45587628-45587650 CCTGGTGGCCAGATTTCTGGCAC 0: 157
1: 314
2: 214
3: 192
4: 217
Right 1173763774 20:45587655-45587677 AGCAAGCTCCTGGGGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173763774 Original CRISPR AGCAAGCTCCTGGGGGATGC AGG Intergenic
No off target data available for this crispr