ID: 1173766983

View in Genome Browser
Species Human (GRCh38)
Location 20:45620539-45620561
Sequence GGAGTACAGCGGTGCTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48708
Summary {0: 1, 1: 4, 2: 173, 3: 4446, 4: 44084}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173766983 Original CRISPR GGAGTACAGCGGTGCTCTCT TGG (reversed) Intronic
Too many off-targets to display for this crispr